Transcript asmbl_17204

Sequence
Transcript Sequence for observation asmbl_17204 of TGE0032146:
CCCACTCCCCGGCGTCTAAACACAGGTGGGAGCGGGAGATCCCGACAGGTGAGCCCCGCGCCCAGCAGTCGCAAGGATGGAGTTCGTCAAGTGTCTAGGCCACCCGGAGGAGTTCTATAACCTGCTGCGATTCCGCATGGGAGGCCGGCGGAATTTTATACCCAAGATGGACCAGGACTCACTCAGCAGCAGCTTGAAGACCTGCTACAAGTATCTCAATCAGACCAGTCGCAGCTTTGCCGCGGTTATCCAGGCGCTGGATGGGGACATACGGCACGCCATATGTGTGTTCTACCTGGTTCTCCGAGCCCTGGATACAGTGGAGGATGACATGAGCATCAGTGTGGAGAAGAAGATCCCACTGCTGTGTAACTTCCACACTTTCCTCTATGACCCAGAGTGGCGGTTCACTGAGAGCAAGGAGAAGGACCGACAAGTGCTGGAGGACTTCCCCACGATCTCCCTGGAGTTTAGAAATTTGGCTGAGAAATATCAAACAGTGATCGATGACATCTGCCACCGGATGGGGTGTGGGATGGCAGAATTTGTAGACAAGGATGTGACCTCCAAACAGGACTGGGACAAGTACTGCCACTACGTTGCTGGGCTGGTGGGAATTGGCCTTTCTCGTCTATTCTCTGCCTCAGAGTTTGAAGACCCCATAGTTGGTGAAGACATAGAGTGTGCCAACTCAATGGGTCTGTTCCTGCAGAAAACAAATATCATTCGTGATTATCTGGAAGACCAACAGGAAGGAAGGAAGTTTTGGCCTCAGGAGGTGTGGGGCAGATACATTAAGAAGTTGGAAGACTTTGCTAAGCCAGAGAACGTAGATGTGGCCGTGCAGTGCTTGAATGAACTCATAACCAACACCCTACAGCACATCCCTGACGTCCTCACCTACCTGTCAAGGCTCCGGAACCAGAGTGTGTTTAACTTCTGTGCTATTCCACAGGTAATGGCCATTGCCACACTGGCTGCCTGTTACAATAACCAGCAGGTATTCAAAGGAGTAGTGAAGATTCGGAAGGGGCAAGCAGTCACCCTCATGATGGATGCCACCAACATGCCTGCCGTCAAAGCTATCATATACCAGTACATAGAAGAGATTTATCACCGGATCCCCAACTCAGACCCATCATCAAGCAAAACCAAGCAGGTCATCTCCAAGATCAGGACACAGAACCTTCCCAACTGCCAGCTCATCTCCCGAAGCCACTACTCCCCCATTTACCTGTCATTTATCATGCTCTTGGCTGCCCTGAGCTGGCAGTACCTGAGCACCCTGTCCCAGGTCACAGAAGACTATGTCCAGAGAGAACACTGATTTTGTTTAGCCGGAAGTGGAAGTTCCCGTGGAGTGGGTTTTTCCTTTTCCTCCAGCTGGATTTTGACTTCCCTTGTTTTTCCTCCTACTCTAAAATCTTTGGGAGAACTGAGTGTGGGACCTTTAGGAACTGGGCAGAGGAAAGGATGCCTTGCCCTCAGCAGCCTGGTGCTGGCTGGGACTTGGTTCCTCTGCCTCTTGTAGCCACTGGCAGCGTGCCGACTGCTGCACTTGTGAGGCCACGTGTGATGGTCACAAGAGCCTAGTGAACCTGGCTAGAATGCTGATTGGATTTATTTAATTTGAAACAGCCTTTGAATACCTATGACAATAGAAAATGAAAGCAACTGGTCCTTGTCTTTCTCATGAGTTTGACAGTGGAAGTGTTAATCCGTGTTGTTCTGCGCGATG