Transcript asmbl_17135

Sequence
Transcript Sequence for observation asmbl_17135 of TGE0032163:
GTGAAAGCGAAAGCTGGGGCTGCTAGCCCAGGCTCGAGAGCTGCCAAGTGGGGGGAAGCATGGCCAAGCCTTGTGGGGTCCGCTTGAGTGGAGAAGCCCGAAAACAGGTGGATGTCTTCAGACAAAATCTTTTCCAGGAGGCTGATGACTTCCTCTGCACTTTCTTGCCACGGAAAATCATATCCCTGAGTCAGCTCTTGCAGGAGGATTCCCTCAATGTGGCCGACCTCTCCTCCCTCCGGGCTCCTCTGGACATCCCTATCCCAGATCCTCCACCCAAGGATGACGAGATGGAAACAGACAAGCAGGAGAAGAAGGAAGTCCCTAAGTGTGGCTACCTCCCGGGGAACGAGAAGCTTCTGGCCTTGCTCGCTTTGGTTAAGCCAGAAGTCTGGACTCTCAAAGAGAAGTGCATTCTGGTAATCACATGGATCCAGCACCTGATCCCCAAGATTGAGGATGGAAATGATTTTGGGGTGGCAATTCAGGAGAAGGTGCTGGAGAGAGTGAATGCTGTCAAGACCAAAGTAGAAGCTTTCCAGACAACCATTTCCAAGTACTTCTCAGAACGAGGGGACGCTGTAGCCAAGGCTTCCAAGGACACCCATGTAATGGATTACCGGGCCTTGGTGCATGAGCGAGATGAAGCAGCCTATGGGGCGCTTAGGGCCATGGTGCTGGACCTGAGGGCCTTCTATGCTGAGCTTTATCATATCATCAGCAGCAACCTAGAGAAAATCGTCAACCCGAAGGGTGAAGAAAAGCCATCGATGTACTGAGCTAAGGATTAGAAGGAAAATAAATGATTTATACTTTA