Transcript asmbl_16910

Sequence
Transcript Sequence for observation asmbl_16910 of TGE0036148:
CCGCCCCCTCTCGGGGCCGACCGCGTCGTCAAAGCTGTTCCTTTTCCCCCAACTCATCGGCTGACATCTGAAGAAGTGTTTGATATGGATGGGATACCCAGGGTTGATGTTCTGAAGAACCACTTGGTAAAAGAAGGGCGGGTGGATGAAGAAATTGCACTAAGAATTATCAATGAGGGTGCTGCCATACTTCGGCGGGAGAAAACCATGATAGAAGTAGAAGCTCCAATTACAGTGTGTGGTGACATCCATGGCCAATTTTTTGATCTGATGAAACTTTTTGAAGTAGGAGGATCACCTGCTAATACACGATACCTTTTTCTTGGTGATTATGTGGACAGAGGTTATTTTAGTATAGAGTGTGTCTTATATTTATGGGTCTTGAAGATTCTATACCCAAGCACATTATTCCTTCTGAGAGGCAACCATGAATGCAGACACCTTACTGAATATTTTACCTTTAAGCAGGAATGTAAAATTAAATATTCAGAAAGAGTCTATGAAGCTTGTATGGAGGCTTTTGACAGCTTGCCCCTTGCTGCACTTCTAAACCAACAATTTCTTTGTGTTCATGGTGGACTTTCACCAGAAATACACACACTGGATGATATTAGGAGATTAGATAGATTTAAAGAGCCACCTGCATTTGGACCAATGTGTGACTTGCTATGGTCTGATCCTTCTGAAGACTTTGGAAATGAAAAATCACAAGAACATTTTAGTCATAATACAGTTCGAGGATGTTCTTATTTTTATAACTATCCAGCAGTGTGTGAATTTTTGCAAAACAATAATTTGTTATCGATTATTAGAGCTCATGAAGCTCAAGATGCAGGCTATAGAATGTACAGAAAAAGTCAAACTACAGGGTTTCCTTCATTAATAACAATTTTTTCGGCACCTAATTACTTAGATGTCTACAATAATAAAGCTGCTGTACTAAAGTATGAAAATAATGTGATGAACATTCGACAGTTTAATTGCTCTCCACATCCTTATTGGTTGCCCAATTTTATGGATGTCTTTACATGGTCTTTACCATTTGTTGGAGAAAAAGTGACAGAAATGTTGGTAAATGTTCTGAGTATTTGTTCTGATGATGAACTAATGACAGAAGGTGAAGACCAGTTTGATGGTTCAGCTGCAGCCCGGAAAGAAATCATAAGAAACAAGATCCGAGCAATTGGCAAGATGGCAAGAGTCTTCTCTGTTCTCAGGGAGGAGAGTGAAAGCGTGCTGACACTCAAGGGCCTGACTCCCACAGGGATGTTGCCTAGTGGAGTGTTGGCTGGAGGACGGCAGACCTTGCAAAGTGCAATACGAGGATTCTCTCCACCACATAGAATCTGCAGTTTTGAAGAGGCAAAGGGTTTGGATAGGATCAATGAGAGAATGCCACCCCGGAAAGATGCTGTGCAGCAAGATGGTTTCAATTCCCTGAACACCGCACATACCACTGAGAACCACGGGACTGGCAACCATAGTGCCCAGTGACCAGCGGCTTCCCAGGGACTCTCACATCTTGGGC