Transcript asmbl_16876

Sequence
Transcript Sequence for observation asmbl_16876 of TGE0032086:
CTTCCATCAAGTGGTGGCCTGGGGACTTGGGACGGACAGTCACCCATGCTGTGGTCCTAGCCCATTTGATCTGCTTAGGAGCCCGGCATGGCATGCATGCCTTCATTGTGCCCATCCGGAGCCTAGAGGACCACACCCCACTGCCAGGAATAACAGTTGGGGACATAGGCCCCAAGATGGGCTTCGAAAACATAGACAATGGCTTCCTGCGACTGAACCACGTGAGGGTTCCCAGAGAGAACATGCTCAGTCGCTTTGCAGAGGTCTTGCCAGATGGCACCTACCAGAGGCTTGGGACACCACAGAGCAATTATCTTGGCATGTTGGTGACACGGGTGCAGCTGCTGTATAAAGGATTCCTACCCACCCTCCAGAAGGCTTGCACCATTGCTGTGCGCTACGCAGTAATCCGCCACCAGTCTCGTCTTCGGCCTAGTGACCCAGAGGCAAAAATCCTGGAATACCAGACACAGCAGCAGAAACTCCTGCCTCAGCTTGCTGTGAGCTATGCCTTGCATTTCATGACCACCAGCCTCTTACAATTCTTCCACAGCTCCTACAGTGATATTCTGAAGAGAGACTTCAGCCTCCTGCCTGAGCTCCATGCACTGAGCACTGGCATGAAGGCCATGTCTTCAGACTTCTGTGCCCAGGGAACAGAGATCTGCCGCAGGGCCTGCGGGGGTCATGGCTACTCAAAGCTGAGCGGCCTACCGACACTGGTCACTCAAGCGATAGCCTCTTGCACGTATGAGGGTGAGAATACGGTGCTCTACCTGCAAGTGGCCAGGTTTCTGATGAAGAGCTACCTGCAGGCTCAAGTGTCCCCAGGATCCATACCACAGAAGCCTCTCCCTCAGTCCGTCATGTATCTCGCCACACCAAGACCAGCCAGGTGCCCAGCCCAGACAGCAGCTGACTTCCGCTGCCCAGAAGTCTATACCACAGCCTGGGCATATGTGTCTGCCAGGCTCATAAGAGATGCAACACAGCATACACAGACCCTCATGAGATCCGGGGTTGACCAGTACGATGCTTGGAACCAGACTTCTGTCATACACCTTCAGGCTGCTAAGGCTCACTGCTACTTCCTCACTGTGAGGAATTTCAAGGAAGCTGTGGAGAAACTAGACAACGAACCAGAGATTCAGCGTGTGCTTCAGAACCTCTGTGACCTCTATGCCTTAAACGGTATTCTGACTAACTCAGGGGACTTTCTGCATGATGGCTTCCTGTCTGGGGCCCAAGTGGACATGGCAAGAACAGCCTTCCTAGACCTGCTTCCCTTGATCCGGAAGGACGCCATCTTGTTAACAGATGCTTTTGACTTCTCGGACCATTGTTTAAACTCTGCACTTGGCTGTTATGACGGACACGTCTACCAACGCCTGTTTGAGTGGGCTCAGAAGTCCCCAGCCAATACTCAGGAGAACCCTGCCTATAAGAAGTATATTAGACCACTGATGCAAAGCTGGAAACCCAAGCTGTGAAAAGCCAAAGGATTCAGGACCAAGCAGCACCATGGCCTTCCTATGGCACATATGCATATAAAGAATTTAAAGCACGGGGTGGCGTGCGGCTTGTTCAGATCAGCGAGTAAACTGGTACATGAAAGGATGTTCATCATATTATTCTGCTACTGAGTACATCTGAAACTTTCCCTTGTCTGTTTGTAGTACGTATTTGGCTAAATGCTAGAATTTTGCTTTAAATACAGCAAAAGCTAATAAACT