Transcript asmbl_162

Sequence
Transcript Sequence for observation asmbl_162 of TGE0032015:
GGCGGAAGAAAAGGGGAGCACTTTCTAGGCTTTTCCAGGCCGGCCGCCGAGGTGAAAGAACGAGCCCCCCTCCCGGAAATGACGCCACTTGACCTTTCACCCACGGGACGCGCGGGGCCTTCCGGAAGGTTCTAGAACGGACCGTGGCCCAGGAACCAGCGTAGGGCGGCGGGAGAGGGCTGAGGCCGCAGAGCTGAGGCGGCTCTGAAATGCTTCGACTACCCACAGTCCTTCGCCAGATGAGACCAGTGTCCCGGGCACTGGCTCCTCATCTCACTCGGGCCTATGCCAAAGATGTAAAATTTGGTGCGGACGCTCGAGCCTTAATGCTTCAAGGTGTAGACCTTTTAGCAGATGCTGTAGCTGTTACAATGGGGCCAAAGGGAAGAACTGTGATTATTGAACAGAGTTGGGGAAGTCCCAAAGTAACAAAAGATGGGGTCACTGTTGCAAAGTCAATTGATTTAAAGGATAAATACAAAAATATTGGAGCTAAACTTGTTCAGGACGTTGCCAATAACACAAACGAAGAGGCTGGGGATGGCACCACCACTGCCACTGTTCTGGCACGATCTATTGCCAAGGAGGGCTTTGAGAAGATCAGCAAAGGGGCTAATCCAGTGGAAATCCGGAGAGGTGTGATGTTGGCTGTGGATGCTGTAATTGCTGAACTTAAGAAACAGTCTAAACCTGTGACAACCCCTGAAGAAATTGCTCAGGTTGCTACAATTTCTGCAAATGGAGACAAAGACATTGGGAACATCATTTCTGATGCAATGAAAAAGGTTGGAAGAAAGGGTGTCATCACAGTGAAGGATGGAAAAACCCTGAATGATGAGCTAGAAATTATTGAAGGCATGAAGTTTGATAGAGGATATATTTCCCCGTATTTTATTAACACATCAAAAGGTCAAAAGTGTGAATTCCAAGATGCCTATGTCTTGTTGAGTGAAAAGAAAATTTCCAGTGTTCAGTCCATTGTCCCTGCTCTTGAAATTGCTAATGCTCATCGGAAGCCATTGGTCATAATCGCCGAAGACGTTGACGGAGAAGCTCTAAGCACGCTGGTTTTGAACAGGCTAAAAGTTGGTCTTCAGGTTGTGGCAGTCAAAGCTCCAGGATTTGGGGACAATAGGAAGAACCAGCTTAAAGATATGGCTATTGCTACTGGTGGTGCAGTGTTTGGAGAAGAGGGGTTGAATCTAAATCTTGAAGATGTTCAAGCTCATGACTTAGGAAAAGTTGGGGAGGTCATTGTCACCAAAGATGATGCCATGCTTTTGAAAGGAAAAGGTGACAAAGCTCACATTGAAAAACGTATTCAAGAAATCACTGAGCAGCTAGACATCACAACTAGTGAATATGAAAAAGAAAAGCTGAACGAGCGACTTGCTAAACTTTCAGATGGAGTAGCTGTGTTGAAGGTTGGAGGAACAAGTGATGTTGAAGTGAATGAGAAAAAAGACAGAGTTACTGATGCTCTCAATGCTACAAGAGCAGCTGTTGAAGAAGGCATTGTTCTAGGAGGGGGCTGCGCTCTGCTTCGGTGCATCCCAGCCTTGGATTCATTAAAGCCTGCTAATGAAGACCAGAAAATAGGTATAGAAATTATTAAAAGAGCACTTAAAATTCCTGCAATGACGATTGCTAAGAATGCAGGTGTTGAAGGATCTTTGATAGTTGAGAAAATTCTGCAGAGTTCCTCAGAAGTTGGTTATGACGCCATGCTTGGAGATTTTGTGAACATGGTGGAAAAAGGGATCATTGATCCAACAAAGGTTGTGAGAACTGCCTTACTGGATGCTGCTGGGGTGGCCTCCTTGCTAACTACAGCCGAAGCTGTAGTGACAGAAATTCCTAAAGAAGAGAAGGACCCTGGAATGGGTGCAATGGGTGGCATGGGAGGGGGTATGGGAGGCGGCATGTTCTAACTCCTAGAGTAGTGCTTTGCCCTTATCAATGAACTGTGACAGGAAGCTCAAGGCAGGTTCCTCACCAATAACTTCAGAGAAGTCACCTGGAGAAAATGACTGAAGAGAAGGCTGGCTGACCACTGTAATCATCAGTTACTGGTTTCCTTTGACGATATATAATGGTTTACTGCTGTCATTGTCCATGCCTACAGATAATTTATTTTGTATTTTTGAATAAAGACATTTGTACATTCCTGATGCTGGGTGCAAGAGCCATATACCAGTGTCCTGCTTTCAACTTAAATCACTGAGGCATCTCTACTGTTCTGTGAGCATCAGGACTGTAGCGCTGTGTCACCACATGAGAGTTCAGAAGCAGCCTTTCTGTGGAGGGTGGGAATGATTGTGTACAAAGTAGAGAAGTATCCAATTATGTGACAACCTTTGTGTAATAAAATTTTGTTTAAAGTTT