Transcript asmbl_15628

Sequence
Transcript Sequence for observation asmbl_15628 of TGE0032043:
CAGCACCCGTCCTCGGTCACTGCTGGTCGCTTCCTGAGCCGCTGCTGGCTCTGTGTCTCTGTCCTCAGCGTTCTCGTCCTCGTCCTCGTCCTCGTCCTACCACGCCATGGAAGGTTACCATAAGCCAGATCAGCAGAAGCTCCAGGCCCTGAAGGACACAGCCAATCGCCTGCGCATCAGCTCCATCCAGGCCACCACCGCGGCAGGCTCAGGCCACCCCACATCATGCTGCAGCGCTGCCGAGATCATGGCTGTCCTGTTTTTCCATACCATGCGTTACAAGGCCCTGGATCCCCGAAACCCTCACAATGATCGATTTGTGCTCTCTAAGGGCCATGCAGCTCCCATTTTATATGCAGTCTGGGCTGAAGCTGGCTTCCTACCCGAGGCCGAGCTGCTGAACCTGAGGAAGATCAGCTCTGACTTGGACGGGCATCCTGTCCCGAAACAAGCCTTCACCGATGTGGCCACTGGCTCCCTGGGCCAGGGCCTGGGAGCTGCTTGCGGGATGGCATACACAGGCAAATACTTTGACAAAGCCAGCTACCGAGTCTATTGCATGCTGGGAGACGGGGAGGTCTCCGAGGGCTCCGTCTGGGAGGCCATGGCCTTTGCTGGAATTTACAAGCTGGACAACCTCGTTGCCATTTTTGACATCAACCGCCTGGGCCAGAGCGACCCAGCCCCGCTGCAGCACCAGGTGGACATCTACCAGAAGCGCTGTGAGGCCTTTGGCTGGCACACCATCATCGTGGACGGACACAGCGTGGAGGAGCTGTGCAAGGCCTTTGGTCAGGCCAAGCACCAACCAACAGCCATCATTGCCAAGACCTTCAAGGGCCGAGGGATCACAGGGATTGAAGACAAGGAGGCGTGGCACGGGAAGCCCCTCCCCAAAAACATGGCCGAGCAGATTATCCAGGAGATTTACAGCCAGGTTCAGAGCAAAAAGAAGATCCTGGCCACGCCCCCTCAGGAGGATGCCCCATCCGTGGACATTGCTAACATCCGAATGCCTACGCCACCCAGCTACAAAGTGGGGGACAAGATAGCCACCCGGAAGGCCTATGGACTGGCCCTCGCTAAGCTGGGCCACGCCAGTGACCGTATCATTGCCCTGGATGGAGACACCAAGAATTCCACCTTCTCGGAGCTCTTCAAAAAGGAGCACCCAGACCGGTTCATTGAGTGCTACATTGCCGAGCAAAACATGGTGAGCATTGCCGTGGGCTGTGCCACACGTGACCGGACAGTGCCCTTCTGCAGTACTTTCGCGGCCTTCTTCACACGGGCCTTCGACCAGATTCGCATGGCCGCCATCTCTGAGAGCAACATCAACCTCTGTGGCTCCCACTGTGGTGTGTCCATTGGGGAAGACGGGCCCTCTCAGATGGCCCTCGAAGACCTGGCCATGTTCCGGTCAGTCCCCATGTCCACCGTCTTTTACCCAAGCGATGGAGTTGCAACAGAGAAGGCAGTGGAGTTAGCAGCCAACACAAAGGGCATTTGCTTCATCCGGACCAGCCGCCCAGAGAATGCCATTATTTATAGCAACAATGAGGATTTCCAGGTCGGCCAAGCCAAGGTGGTCCTGAAGAGCAAGGATGACCAAGTGACAGTGATCGGGGCTGGTGTAACTCTGCATGAGGCCTTGGCTGCTGCAGAGAGTCTAAAGAAAGATAAGATCAGCATCCGGGTGCTGGATCCCTTCACTATCAAGCCCCTGGACAGGAAACTCATCCTAGACTCTGCCCGAGCAACCAAAGGCAGGATCCTCACCGTGGAGGACCACTACTACGAAGGTGGCATAGGAGAGGCAGTGTCTGCTGCCGTAGTGGGTGAACCTGGAGTGACGGTCACTCGCCTGGCTGTCAGCCAAGTACCACGAAGTGGCAAGCCAGCTGAGCTACTGAAGATGTTCGGTATTGACAAGGACGCCATTGTGCAAGCTGTGAAAGGCCTTGTCACCAAGGGCTAGGGAGGGCATGGGATGCTGGGTGGGTGAACTACACATTCCAGGGAGGTTCTGGCAGAGGTGGCGAAGGTGTACTGAGTGGGGAGGTAAATATATGTTTTGAGAAAAAA