Transcript asmbl_15596

Sequence
Transcript Sequence for observation asmbl_15596 of TGE0003333:
GTTGATATGATTGGTCGGCAGTGAGCGGTCCTCTTTTCCTCCTCTCCAGCTCCGGCGCCGTAGCCATCATGAATGACACAGTAACCATCCGGACCAGGAAGTTCATGACCAACCGTCTGCTTCAGAGGAAACAGATGGTCATTGATGTCCTTCATCCTGGGAAGGCAACAGTACCAAAGACAGAAATTCGGGAAAAGCTGGCCAAAATGTACAAAACCACACCAGATGTCATCTTTGTATTTGGATTCAGAACCCACTTCGGTGGTGGCAAGACCACTGGCTTTGGCATGATCTATGATTCTTTAGATTATGCAAAGAAGAATGAGCCTAAACACAGACTGGCAAGACATGGCCTTTATGAGAAGAAAAAGACCTCCCGAAAACAGCGAAAGGAACGCAAGAACAGAATGAAGAAGGTCAGGGGCACGGCGAAGGCCAATGTTGGTGCTGGCAAAAAGTGAGTGGAGATTGGATACAGCCAAAGGAGTAGATCTGCGGTGACTTGATGTTTTGCTGTGATGTGCAGATTTCTGAGAGGACAAATAAACTAAAAAGCTCCTACA