Transcript asmbl_15594

Sequence
Transcript Sequence for observation asmbl_15594 of TGE0032038:
GCGCGGTAGACAGCCCGGGCGGCCGCGGCGGGGACCTGGCTGGGGGAGGCCAGGCTTGCGGCGGGGCGCAACGGTGTCTCCTTCACTTCGCCCTCCAGCCGCGGTGGCTGCAGCGCAACTTTCAGATAGCGGAGTGGCCTCAGCTGCGAGCCGAGCGGTGGCGGCAGCGCCCCTCAGGACACCCGCAGATCACCTTTTCCCCGCGACTTCGCCATGGCTGAGTGCTGTGTACCGGTATGCCCACGGCCGATGTGTATCCCTCCACCCTATGCTGACCTCGGCAAAGCTGCCAGAGACATTTTCAACAAAGGATTTGGCTTTGGGCTGGTGAAGCTGGATGTGAAGACGAAGTCATGCAGCGGTGTGGAATTTTCAACATCTGGCTCATCTAATACAGACACTGGTAAAGTTAGCGGGACCTTGGAGACCAAGTACAAATGGTGTGAGTATGGTCTGACTTTCACAGAGAAGTGGAACACCGATAACACTCTGGGGACAGAGATTGCAATTGAAGACCAGATTTGTCAAGGTTTGAAACTGACTTTTGACACCACCTTTTCACCGAACACAGGAAAGAAAAGTGGTAAAATCAAGTCTGCTTACAAGAGGGAGTGTATAAACCTCGGCTGTGATGTTGACTTTGATTTTGCTGGACCTGCCATCCATGGGTCAGCTGTCTTTGGTTACGAGGGCTGGCTTGCTGGGTACCAAATGACCTTTGACAGTGCCAAGTCAAAGCTGACAAGGAGTAACTTTGCAGTCGGCTACAGGACTGGGGACTTCCAGCTACACACAAATGTAAATAATGGGACAGAATTTGGAGGATCAATTTATCAGAAAGTATGTGAAGATTTTGACACTTCAGTAAACCTCGCTTGGACATCAGGTACCAACTGCACTCGTTTTGGCATTGCAGCTAAATACCAGTTGGATCCTACTGCTTCTATCTCTGCAAAGGTCAACAACTCTAGTTTAATTGGAGTGGGCTATACTCAGACTCTGAGGCCTGGTGTGAAGCTTACACTGTCTGCTCTGGTAGACGGGAAGAGCTTTAATGCTGGAGGCCACAAACTTGGGCTTGCCTTGGAATTGGAGGCTTAATCCAGTTAAAAGAAACCTCTGGGAACGAATATCAGAAGATTTGGCCTTAATATATTTCCATGCGACCAGCAGGCTCCCCTTCCTTCCCCCAGAAGGTGATCACATCAAAGGATGATGAAGCAAGAGCTGTATTTTAAATATTTAGACAGTCACTGTTGGCTGGTTCCTAGTTGGATGGTTATCAGTGCTGCCGTGGTGCGGCCCCCTATACATTATTTAAATGTATTTAACTGTTAAATGTGCTACCCACCAATGATGAAATAGACGTTTATGAAAACCGTGCCATGGTGTGCATGTTTGTTTTATGTTCCTTTTAACATTGACTATTGTACTGAATGAGATGGATCAGTGGCTGTTTTAAGATGAGGTAAAAGATTTTTTTTTGTTATATTCACCCATCATTAGAATTACTTTGGTAACCCCAAACATGACAAATTATGAATAAAACAAGTGTACATAACTAATGGCTCACGTATGTGCAGTTACAGATTGCCAGCCTAGGGTCTAATCTTCTTGGCAAATACTTTTTTCTGGTGAGCATTTTGCTCTTTACCTAAACCTGTGCAACCAAATTCCTTGTGTCCCTAGCATAATCCACGAGGTCTTTGAGATTACAATAAAATACAAGGATACATACTTTAA