Transcript asmbl_14192

Sequence
Transcript Sequence for observation asmbl_14192 of TGE0032012:
GTCGCTGTGTGCGCTCCGCGTGTGCAGCCGCGTGGGCCATGGGGCGGCGGGCGCGGGGCCGGCGGTTCCAGCAGCCGCCGCAGCCTGAGGGCGAGGAAGACGCCAGCGACGGCGGCAGAAAGCGAGGCCAGGCGGGCTGGGAAGGTGGCTATCCCGAGATCGTAAAGGAGAACAAGCTCTTCGAGCACTACTATCAGGAACTCAAGATCGTGCCAGAGGGAGAATGGGACCAATTCATGGAGTCACTCCGAGAACCTCTCCCAGCCACACTGAGAATCACTGGGTACAAAAGCCATGCCAAAGAGATTCTCCATTGCTTGAAGAACAAGTACTTTAAGGAGTTGGAGGACCTGGAAGTAGATGGACAGAAAGTTGAAGTTCCACAACCACTAAGCTGGTACCCTGAAGAACTTGCCTGGCATACAAACTTAAGTCGGAAAATCTTGAGGAAGTCCCCGTTGTTGGCAAAGTTCCATCAGTTCCTGGTCAGCGAGACTGAGTCTGGAAACATCAGCCGCCAGGAGGCTGTCAGCATGATCCCCCCACTGCTGCTCAACGTGGAGCCACACCATAAGATCTTAGACATGTGTGCAGCCCCTGGATCCAAGACCACACAGTTAATTGAAATGTTGCATGCAGACATGAGTGTGCCCTTTCCAGAGGGATTTGTAATCGCAAATGACGTGGACAACAAGCGCTGCTATCTGCTCGTCCATCAGGCCAAAAGGTTGAGCAGTCCCTGCATCATGGTGGTAAACCATGACGCATCCAGCATACCTAGACTTACAGTAGATGTGGACGGAAGGAAAGAGATTCTCTTCTATGATCGAATTTTATGTGATGTCCCTTGCAGTGGCGATGGCACAATGAGAAAAAACATTGATGTCTGGAAGAAATGGACAACCTTAAACAGCTTGCAGCTCCATGGCCTGCAGCTTCGGATTGCAACTCGAGGTGCTGAGCAGCTGGCGGAAGGTGGCAGGATGGTGTATTCCACGTGTTCCTTGAACCCCGTGGAGGATGAAGCAGTGATCGCAGCTCTGCTAGAGAAGAGTGAAGGAGCTCTTGAGCTTGCTGATGTGTCTGCTGAGTTGCCAGGACTGAAGTGGATGCCTGGAGTCTCACAGTGGAAGGTCATGACTAGAGACGGGCAGTGGTTTGCAGACTGGCATGAGGTTCCCCAGGGCAGGCATACACAAATCCGACCTACCATGTTCCCACCAACGGACCTGGAGAAGCTACAGGCAATGCATCTAGAGCGATGCCTTCGAATCCTGCCCCATCATCAGAATACTGGAGGGTTCTTTGTGGCAGTATTGGTCAAGAAAGCACCAATGCCGTGGAACAAACGTCAGCCCAAGGTCCAGAATAAATCTGCAGAAGCCAGAGAACCCAGGGTATCCAGCCATGTGGCTGCCACAGAGGGAAATCCCAGTGACCAGTCTGAGCTGGAAAGTCAGATGATAACTGGAGCTGGTGACTCAGAAACAGCTCACAACACTGAGAACACAGAGAGCAATGAGAAGAAAGATGGCGTGTGTGGCCCTCCTCCATCAAAGAAAATGAAGTTGTTTGGATTTAAAGAAGATCCATTTGTATTCATTCCTGAAGATGATCCTTTATTTCCACCTATTGAGAAGTTTTATGCCTTGGATCCTTCATTCCCGAGGATGAATCTGTTAACCCGAACCACAGAAGGAAAGAAGCGGCAGCTTTATATGGTCTCCAAGGAGCTGAGGAATGTACTGCTGAACAACAGCGAGAAGATGAAGGTCATTAACACTGGGATAAAAGTCTGGTGTCGAAATAACAGTGGTGAAGAATTCGATTGTGCATTCCGTTTGGCACAGGAGGGAATATATACATTGTATCCATTTATCAATTCAAGAATCATCACTGTATCAATGGAAGACGTGAAGACACTGTTGACCCAGGAGAACCCATTCTTTAGAAAACTGAGCAGTGAGGCCTACAGTCAAGTCAAGGACCTTGCAAAGGGAAGTGTTGTGCTGAAGTATGAGCCAGATTCTGCGAATCCAGACACCCTCCAGTGCCCCATCGTGCTGTGTGGGTGGCGGGGAAAGGCCTCTATTCGAACTTTTGTGCCCAAAAATGAGCGGCTTCATTATCTCAGGATGATGGGTCTGGAGGTACTGGGAGAAAAGAAGAAAGAGGGAGTCATTCTTACCAATGAGAATGCTGCCAGCCCAGAGCAGCCTGGAGATGAGGATGCCAAGCAGACAGCACAAGACCCCTGCGTCCCAGACTCCGTCCCTGGCTGTGATGCAGCTGCAGCTGAGCCATCCCGGTGAAGGAGTCTTCACACAATGAATTGGTACCATCCGTTGTTGGAGATCAAACCTAGAATGTCCTTAGCCAGGGACCTGGAAATGAGTGGTGGCCACAGTCTGTTAGGAGTCGCTTTTGCAGAGTGGATACATGTTTCTGCTGTTAAAGGCTAACAGCCTTTGCAGAAGTTCAGATCCCTTGTTGGCCAGTATTGACCTAGTCTTCTAAAACGACAGTAAAAGTCTACAAGTCTTTGGGAAGCAGCTCTATCTATCTATGCTTTAATACTTTCTGGACTGCACACCAGTGTGCTGTGCAGTCATGCTGACACTGAGGTCTCAGGTGACTTCTGTGCCTTTGTGATAAAGGGTGAGATAAGCCATCTCAGAGGGAAGGCTGGTGAATCATGACAGCAGTTTTGGGGACCGTTTGTGCTTATCCTGGAGTTGTTTTAAGTGGGGTGGAGATTGCTTGGGTCATGAAATAAAGAGCTATTATGATCATGTATCTTGGCATGAGACTTGGATTTGCTTTTAGTTGGCTAATGGGAGAGAAAAGCCAGCCCTCTGGTGTCTCATACAGGACTTGAAGCTGGACTGTCAGCCGTGTTTCCCTCGCCCAGATTCTCCCGGCAGAGTCCTTGCAGGAGCTCTTCCTTCCCTCTGTCTGTAATGCATTTTGTCCGCACAGTTGAGCATCAGTTACACCAATGCTCTTCCGGCCTCCCTATATGTGCTCTGAGCTAAACAGG