Transcript asmbl_19654

Sequence
Transcript Sequence for observation asmbl_19654 of TGE0000526:
TGTGGTATCAGGGCCCCGTGCCCAGCTCTTTGCCTGCCTGCTCAGGCTGGGCACTCAGCAGGTCGGCCCCCTTCAGCTGCACACCGGGGCCAGCCATGCGGCCAGGAACCATTATGAGGTGCTGGTGCTGGGTGGGGGCAGTGGCGGAATCACCATGGCTGCCCGCATGAAGAGGAAAGTGGGTGCAGAGAATGTGGCCATTGTTGAGCCCAGTGAGAGACATTTCTACCAGCCAATCTGGACACTGGTGGGTGCTGGTGCCAAACAATTGTCCTCATCTGGTCGTCCCACGGCAAGTGTGATTCCATCTGGTGTAGAATGGATCAAAGCTAGAGTGACTGAGTTGAACCCAGACAAGAACTGCATTCACACAGATGACGACGAGAAGATCTCCTACCGATATCTTATTATTGCTCTCGGAATCCAGCTGGACTATGAGAAGATTAAAGGCCTACCTGAAGGTTTCGCTCATCCCAAAATAGGGTCGAATTATTCAGTTAAGACTGTAGAGAAGACATGGAAAGCTCTGCAGGACTTCAAAGAGGGCAATGCCATCTTCACCTTCCCAAATACTCCAGTGAAGTGTGCTGGAGCCCCTCAGAAGATCATGTACTTATCAGAAGCCTACTTCAGGAAGACAGGGAAGCGATCCAAGGCCAATATCATTTTCAACACTTCTCTTGGAGCCATTTTCGGGGTTAAGAAGTATGCAGATGCCCTGCAGGAGATCATCCAGGAGCGGAACCTCACTGTTAACTACAAGAAAAACCTCATTGAAGTCCGAGCCGATAAACAAGAGGCTGTATTTGAGAACCTGGACAAACCAGGAGAGACCCAAGTGATTTCATATGAAATGCTTCATGTCACACCTCCAATGAGCCCACCAGATGTCCTCAAGACCAGTCCTGTGGCTGATGCTGCTGGTTGGGTGGATGTGGATAAAGAAACTCTGCAACACAGGAGGTACCCAAATGTGTTTGGGATTGGGGACTGCACCAACCTTCCTACGTCAAAGACCGCTGCTGCAGTAGCTGCCCAGTCAGGAATACTTGATAGGACAATTTCTGTAATTATGAAGAATCAAACACCAACAAAGAAGTATGATGGCTACACATCATGTCCACTGGTGACCGGCTACAACCGTGTGATTCTTGCTGAGTTTGACTACAAAGCAGAGCCGCTAGAAACCTTCCCCTTTGATCAAAGCAAAGAGCGCCTTTCCATGTATCTCATGAAAGCTGACCTGATGCCTTTCCTGTATTGGAATATGATGCTAAGGGGTTACTGGGGAGGACCAGCGTTTCTGCGCAAGTTGTTTCATCTAGGTATGAGTTAAGGATGGCTCAGCACTTGCTCATCTTGGATGGCTTCTGGGCCAAAACTGCAGTCACTGAATGACCAAGAGCAGCACGAAGGACTTGGAACCTATCCTTGTAAAGAGTTCCTTGATGGGTAATGGTGACCAAATGCCTCCCTTTTCAGTACCTTTGAACAGCAACCATGTGGGCTACTCATGATGGGCTTGATTCTTTG