Transcript asmbl_13822

Sequence
Transcript Sequence for observation asmbl_13822 of TGE0036026:
CCCGGAACAACATGGCTACAGTGTTTCGGCCCCTGGAACGCCTGCGGGTGCCGCGTCCTTCGCTGCATCCCGGGGTGACGGGCTCAGGCTCCGCCTGCTGCCGCTGCACTCTCGGAGCTAAAAGATACCTACTCACAGATAACATTGTGAAGTTAAAGGAATTTCAACATAAGAAGATAGCTATTGCATATAACCTACCTGGCACCAAAGAAATCTATTTCAGAAACTTGGAAGAGAAGTTGACCCAGAACAAACTCATCTTGAAGGAAGAGTTGAAAACGCTGCTGTACCTGTGCCAGTCCCTGGAAGATGTGCAGCTGGCGAAAGCCGTCATTTATAGGTACCATGCAGAAAACAAGAATTTCACTTTGGGGGAATACAAGTTCGGACCAGTTTTCATGAGGCTGTGCTACGAGCTGGACCTGGAGGACTCTGCAGTGGAGCTCGTCAGAGACAAGCATCTACAAGGCTTCTTCCTAGATTCAACGTCATTCAATATTTTGATGGATATGTTATTTACCAAAGGCAAATATGAACGTGCACTTCAAGTGTTGATCGAAATGAAAAACCAAGATGTGAGGTTCAGCAAAGAAACCTACATCCTCGCTTTTGCAATCTGCTACAAACTGAATACCCTGGAATCGCTTAAAATCTGTACTACGTTAAGAGAAGAAGCCCTAATTAAGGGAGACATTATCTGCAGGAGAGCATACTGTTTTGTAGTGGCATTAGCTCTGAATAAGAACCAGTTGAAAAACGCTGTGTCCATTTTTTCTCAAATCGTGAATCCAGAAAGCATAGTGTGTATTAACTTAAATATCTTGATCCACATCCAGTCAAATATGTTGGAAAGCCTGTTAAAGATCTTAGAGGACTCTCTTGACACAAATTTATCGAAATTTGTAAGAAGACACACATTCTCAGAGGAAGTGCTGGCCAAAGTGAGGGAAAAACTGAAGGACAGCCCTGCACTCATAGCCAGATTCGATGAGGTCTATGGGAAGCTGCACGTGAACGGTCAAATCACCGTTCATTCTTTGGATGCTCTGCTCTGCCACGTCCCCCGGGACAAGAGATCCAACTTGTTGCTGTTAAAGAAGAGGGCAGTCAGCCACCGGACCTTACAGCCTCTCAGCCGGTCCCTGCTGACCGAGTAACTGCTTTCCATTTCCCTGGTCTGGAGCAGCTGCTGCTACAGTGGATTACTGGCTGCTCCGGGCCGGGCATCTTACTTACTTCAGTGGCCCTGTGCTGACGCTTGGTCTCCCTAAGTCCTAAGTCCCCCGAGTGGTGACATGCTACCAGAGAAATGGGAAGAGCTAGCTCGAGCCAAGGGAGCCCCACAGAAAGGCAGCTGCCCTCGTTTCACAGGCTCCAGAGTAAGACTCAGAGCTGCTAATGCAGCCCAGTAGAGTGGAGCTCAGGAGGTACCCACAGACGGGATTTCTCTTGGTCTTGACTGACCTTTCACGGCAGAGGTGACTCGCAAGTTGGTGGGGAGACCTGAAACCCTCATCTCCCATCTTTGGAAGTGGCGGAGGCCTTCCTCGTCTCCGCCATCGTTATTCCATCTGTGAGGCGATGCTGCCTGGGTGTGCTTGGATGACTTCACATTTCCATTCAAGGTTCAGTAGAGTTCAGCTTTCTCCAGAATAAGAAATAAAAGGTTCCTGTG