Transcript asmbl_12288

Sequence
Transcript Sequence for observation asmbl_12288 of TGE0031860:
GGCGGTGGCGATTTGGAGGACTGAAGGAAGATGGGTCAAAGCCAGAGTGGTGGCCATGGTCCTGGGGGTGGCAAGAAGGATGACAAGGACAAGAAAAAGAAATACGAACCTCCTGTCCCAACTAGAGTGGGGAAAAAGAAGAAGAAAACAAAGGGACCAGATGCTGCCAGCAAACTGCCACTGGTAACACCTCACACCCAGTGCCGCCTGAAATTACTGAAGCTAGAGAGAATAAAAGACTATCTTCTCATGGAGGAGGAATTCATTAGAAACCAGGAACAGATGAAACCATTAGAAGAAAAGCAAGAGGAGGAAAGATCAAAAGTGGATGATCTCAGGGGGACCCCCATGTCTGTAGGAACCTTGGAAGAGATCATTGATGATAATCACGCCATTGTGTCCACATCTGTGGGCTCAGAACACTACGTCAGCATCCTGTCGTTTGTAGACAAGGATCTGCTGGAACCAGGCTGCTCCGTCCTGCTCAACCACAAGGTGCATGCTGTGATAGGGGTGCTAATGGATGACACGGATCCCCTGGTCACAGTGATGAAGGTGGAAAAGGCCCCCCAGGAGACCTACGCAGATATTGGGGGACTGGACAACCAGATCCAAGAAATTAAGGAGTCTGTGGAGCTCCCGCTTACCCATCCTGAGTATTACGAGGAGATGGGGATAAAGCCCCCTAAGGGGGTCATTCTCTACGGTCCGCCAGGAACAGGTAAAACTCTATTGGCCAAAGCAGTAGCGAACCAGACTTCAGCCACTTTCTTGCGAGTGGTTGGCTCAGAGCTTATCCAGAAGTACCTAGGTGACGGGCCCAAACTTGTCCGGGAGCTCTTCCGGGTCGCTGAGGAGCATGCGCCGTCCATCGTGTTCATTGATGAGATCGACGCCATTGGGACCAAAAGATATGATTCAAATTCTGGAGGTGAGAGAGAAATTCAGCGAACAATGTTGGAACTGTTGAACCAGTTGGATGGATTTGATTCGAGGGGAGATGTAAAAGTTATCATGGCCACAAACCGAATAGAAACTTTGGATCCAGCACTTATCAGGCCAGGCCGCATTGACAGAAAGATCGAGTTCCCCCTGCCGGATGAGAAGACCAAGAAGCGTATCTTCCAGATTCACACCAGCAGGATGACACTGGCTGATGATGTAACCTTGGATGACTTGATCATGGCAAAGGATGACCTCTCTGGGGCCGACATCAAGGCAATCTGTACAGAAGCTGGCTTGATGGCCTTGCGGGAACGCAGAATGAAAGTAACAAATGAAGACTTCAAAAAATCTAAAGAGAATGTTCTTTATAAAAAACAAGAAGGCACCCCTGAGGGGCTCTATCTCTAGTGGCCCACAGTCGTCCTCAGGGATGGGGAGCTGTCCCCAGGAACCCATTCTCCAGTTCAGGTTTGCCAGTAGAAAGCCTGTATCGTGGAGGACACTGTGCCTCCATCTGTTGTTGGTCATTGTGCCGTGCTGCTCTCTACTCCCAATAAAGGATTGGCCTGGTTTGCTTTCTA