Transcript asmbl_35371

Sequence
Transcript Sequence for observation asmbl_35371 of TGE0005119:
AGGAAACTTGAACGTAACTTCAAAAGAAGATTTGATTTTTTTGTATCTGGATCACGTATATACAGCAAGACCGTCAGAATGTCGGGAGCCTCAGTGAAGGTGGCTGTCCGCGTGCGGCCCTTCAATTCTCGAGAGACCAGCAAAGAGTCCAAGTGCATCATTCAGATGCAAGGCAACTCCACCAGTATTGTTAACCCAAAGAACCCAAAGGAAGCTCCAAAGTCCTTCAGCTTTGACTACTCCTACTGGTCTCACACCTCGCCAGAAGATCCCTGTTTTGCATCTCAAAACCGAGTGTACAATGATATTGGAAAGGAAATGCTCTTACATGCTTTCGAGGGATATAATGTCTGTATTTTTGCCTATGGGCAGACTGGTGCTGGGAAATCTTACACGATGATGGGTAAACAAGAAGAAAGCCAGGCTGGCATCATTCCACAGCTGTGTGAAGAACTATTTGAGAAAATCAATGACAACTGTAATGAAGACATGTCTTACTCTGTAGAGGTGAGCTACATGGAAATTTACTGTGAAAGGGTACGCGATTTGCTGAATCCAAAAAACAAGGGTAATTTGCGCGTGCGTGAGCACCCACTTCTTGGCCCGTATGTGGAGGATCTGTCAAAGTTGGCAGTCACTTCCTACACAGACATTGCTGACCTCATGGATGCTGGGAACAAAGCCAGGACAGTGGCAGCTACCAACATGAATGAAACAAGTAGCCGTTCCCACGCTGTGTTTACAATTGTTTTCACCCAGAAGAAACATGACGCCGAGACCAACCTTTCCACTGAGAAGGTCAGTAAGATCAGCTTGGTGGATCTAGCGGGAAGTGAACGAGCTGACTCAACTGGTGCCAAAGGGACTCGATTAAAGGAAGGAGCAAATATTAATAAGTCTCTTACAACTCTGGGCAAAGTCATTTCAGCCTTGGCAGAGGTGAGTAAGAAGAAGAAGAAAACTGATTTTATTCCCTACAGGGATTCTGTACTTACTTGGCTCCTTCGAGAAAATCTAGGTGGCAATTCTCGGACTGCCATGGTTGCTGCCCTGAGCCCAGCAGATATCAACTATGATGAAACTTTGAGCACTCTGAGGTATGCAGATCGTGCAAAGCAGATTAAATGCAATGCTGTTATCAATGAGGACCCCAATGCCAAGCTGGTCCGTGAACTAAAGGAGGAGGTGACGCGGCTGAAGGATCTTCTTCGTGCTCAGGGCCTGGGAGACATCATCGATACGTCCATGGGGTCCCTTACTTCATCTTCATCTTCCTGCTCACTCAATAGTCAGGTGGGCTTAACATCTGTGACCAGTATTCAGGAGAGGATCATGTCTACCCCCGGAGGAGAGGAAGCCATCGAACGTCTGAAGGAGTCTGAGAAGATCATTGCTGAGTTGAATGAAACCTGGGAAGAGAAGCTGCGTAAAACAGAGGCCATCAGAATGGAGAGAGAGGCCTTGTTGGCTGAGATGGGCGTTGCCATCCGGGAAGATGGAGGAACCCTGGGCGTTTTCTCACCTAAAAAGACCCCACATCTCGTTAACCTCAATGAGGACCCACTAATGTCGGAATGCCTGCTTTATTACATCAAGGATGGACTTACAAGGGTCGGCCAGGCGGATGCCGAGAGGCGCCAGGACATCGTGCTGAGTGGGGCGCACATTAAAGAAGAGCATTGTGTCTTCCGGAGCGAGAGGAGCGACAGCGGGGATGTTATCGTGACGCTAGAGCCCTGTGAACGCTCAGAAACCTACGTAAATGGCAAGAGGGTGGCCCAGCCTGTTCAGCTGCGTTCAGGAAACCGTATCATCATGGGTAAAAACCACGTGTTTCGTTTTAACCACCCCGAGCAAGCACGGGCTGAGCGGGAGAAGACACCCTCTGCCGAGACCCCCTCTGAGCCTGTGGACTGGACGTTTGCCCAGAGAGAGCTTCTGGAAAAACAGGGGATTGATATGAAACAGGAGATGGAGAAAAGGTTACAGGAAATGGAGATCCTGTACAAAAAGGAGAAAGAGGAAGCAGACCTTCTCCTGGAGCAGCAGAGACTGGACGCGGATTCTGATAGCGGGGATGATTCTGACAAGAGGTCCTGCGAAGAGAGCTGGAAACTGATTACTTCTTTGAGAGAAAAGCTACCTCCCAGCAAGTTGCAAACCATTGTTAAAAAATGTGGCCTCCCGAGCAGTGGGAAGAAACGGGAACCAATTAAAATGTACCAGATACCCCAAAGAAGGCGCCTCAGTAAAGATTCCAAGTGGGTCACCATCTCAGACCTTAAGATTCAGGCCGTCAAAGAGATTTGCTACGAGGTGGCGCTCAACGATTTTAGGCACAGTCGGCAGGAGATCGAAGCCTTGGCCATCGTTAAGATGAAAGAGCTTTGCGCCACGTACGGGAAGAAAGATCCCAACGAGCGGGACTCCTGGAGGGCGGTGGCCAGGGATGTCTGGGACACCGTGGGAGTAGGCGACGAGAAGATCGAAGATGTGATGGCCAGTGGTAAAGGCGGAACCGACGTGGATGACCTCAGGGTTCACATAGACAAGCTGGAAGATATTTTGCAAGAGGTCAAAAAGCAAAATAACATGAAAGACGAGGAGATAAAAGTCTTAAGAAATAAAATGCTCAAAATGGAGAAAGTCTTGCCACTGATCGGGTCGCAGGAACAGAAGACCCAAGGAAACCATAAAGCGAAGGAACCTGTCGGTGCCGGCGTCAGTAGCAAGTCTGAGAATGACGTCAGTAAAGGAGACGGTGGGGAGCTTGGGTTGTTTCCCAGCTGATGAACGGGGACCCAGCTTTCCGACGTGGACGTCTGCGCTGGATGAGGCAGGAGCAGATCCGGTTCAAGAACCTGCAGCAGCAGGAGATAACAAAGCAGCTTCGTCGGCAGAACGTGCCCCATAGGTTCATCCCTCCTGAGAACCGGAAGCCCCGCTTCCCCTTTAAGAGCAATCCTAGACACAGGAACTCTTGGAGTCCTGGCACACACATCATCATAACGGAAGACGAGGTTATAGAGCTTCGAATACCGAAGGATGAAGACGGAAGGAAAGGAAATAAAGAGGAGAGCCAAGAGAAGGGTGGTAGAGCAGCTTCTAAGGACCCCCAGTTACCATGGGGCTCTCAGGTCACCCGAAGTCAAGATCACATCCAAGTGAGCAAGCAGCACCTTAATACTCAACAACAGCCACCTCAGTTACGCTGGAGGAGCAATTCCCTCAATAACGGCCAGCAGAAGAGCGTGCGCTGCCAGGCATCTGCCTCCTCGGAGTCGTTAAACTCCCACGGAGGTCACCCCACCGCCGATCTGCAGACTTTCCAGGCCAAGCGCCATATCCATCAACACCGTCAGTCTTACTGTAATTATAACACTGGAGGTCAGTTAGAGGGCAGTGCGGCCAGTTCCTATCAGAGGCAGACTGACAAAGCCAACCACTGTAGCCAGTTTGTGACACCTCCGCGGATGAGGCGACAGTTCTCGGCACCCAATCTCAAAGCTGGTCGAGAAACCACAGTATAAATTACTGGACAAACTTGAAATCCCAGTGGAGGAAGCAGACGATGTTAGCTCCTGATTTGAGTTGGTTCTAGCCTTGGCCTTGAGTTCCTACTAATTACATCATGATTTGAATGTCGCGTTCTTACAAACATTAACTGATTTTCATACTGTCAAAACATAAAACACTGGTCAATGTTTCAACGCCTCCCTTTTGTTTGTATACCATAAATGGGCAGTTTCTGGAATTTTGGACAAAATACTGAGACCTCTCTTTTTTGCTGAGACTTTCCTCCTTTCTTGGTGCCTAGATAATATACTTACTTACAGACTGGTCTCGTTTGGTATAAGTTTGTTATGTTTTTATAACGCCTATAAGTTGATCTGATATCCAGAAAGACCTGCCTCTTGGTTTATGCACACATTCAAAAGGGGAATTGGATACATAGAAATAAATGTCTGTTGTTTCCCCATGAATGTTAGACGTTAGTTTAAAAATAATAACATGCAACTATGTGGACATAGCTTTGGATTTCTCATCCGTGTCTGTCCTTTTGAAAAAGATAATTGGACTTTTCATAAGCCAAAATGAAACGTCTTCAGACACATTTTGTAGTACACAGCTCTGCCTCTTCCACAGAACTTTACATCTTATTCTACATTTTACACAGAACTAATTTCAGTAGGATTTTTTTTCTTTTGAATGTATCAGTGTATGTATGAAATTTGTCATAATACTGAAATATTTGGCACCATATCTGGATTTCTGTTTGTAGTTTGAATTTTGAAATGATCATTTCTCACACGCACTGAACTATTCACCAAAACCATGCCACCAGAAATACCAGAAAAATGCTTCAAGCCGTATATATAAGTTTATAGGGAAGTTCTTTGGTGGAGAGAGGGAAG