Transcript asmbl_19634

Sequence
Transcript Sequence for observation asmbl_19634 of TGE0000524:
GCCGGGTTTGGGGGTTGGGACCTCCGGCTGCAGGTCCGCCTGGGCCAGACGCGCGAGCGCAAGCAGCGGGTTAGTGGTCGCGCGCCCGACCTCCGCAGTCCCAGCCGAGCCGCGACCCTTCCGGCCGTCCCCACCCCACCTCGCCGCCATGCGCCTCCGCCGCCTAGCGCTGTTCCCGGGTGTGGCGCTGCTTCTTGCCGCGGCCCGCCTCGCCGCTGCCTCCGACGTGCTAGAACTCACGGACGACAACTTCGAGAGTCGCATCTCCGACACGGGCTCTGCGGGCCTCATGCTCGTCGAGTTCTTCGCCCCCTGGTGTGGACACTGCAAGAGACTTGCACCTGAGTATGAAGCTGCAGCTACCAGATTAAAAGGAATAGTCCCATTAGCAAAGGTTGATTGCACTGCCAACACTAACACCTGTAATAAATATGGAGTCAGTGGATATCCAACCCTGAAGATATTTAGAGATGGTGAAGAAGCAGGTGCTTATGATGGACCTAGGACTGCTGATGGAATTGTCAGCCACTTGAAGAAGCAGGCAGGACCAGCTTCAGTGCCTCTCAGGACTGAGGAAGAATTTAAGAAATTCATTAGTGATAAAGATGCCTCTATAGTAGGTTTTTTCGATGATTCATTCAGTGAGGCTCACTCCGAGTTCCTAAAAGCAGCCAGCAACTTGAGGGATAACTACCGATTTGCACATACGAATGTTGAGTCTCTGGTGAACGAGTATGATGATAATGGAGAGGGTATCATCTTATTTCGTCCTTCACATCTCACTAACAAGTTTGAGGACAAGACTGTGGCATATACAGAGCAAAAAATGACCAGTGGCAAAATTAAAAAGTTTATCCAGGAAAACATTTTTGGTATCTGCCCTCACATGACAGAAGACAATAAAGATTTGATACAGGGCAAGGACTTACTTATTGCTTACTATGATGTGGACTATGAAAAGAACGCTAAAGGTTCCAACTACTGGAGAAACAGGGTAATGATGGTGGCAAAGAAATTCCTGGATGCTGGGCACAAACTCAACTTTGCTGTAGCTAGCCGCAAAACCTTTAGCCATGAACTTTCTGATTTTGGCTTGGAGAGCACTGCTGGAGAGATTCCTGTTGTTGCTATCAGAACTGCTAAAGGAGAGAAGTTTGTCATGCAGGAGGAGTTCTCGCGTGATGGGAAGGCTCTGGAGAGGTTCCTGCAGGATTACTTTGATGGCAATCTGAAGAGATACCTGAAGTCTGAACCTATCCCAGAGAGCAATGATGGGCCTGTGAAGGTAGTGGTAGCAGAGAATTTTGATGAAATAGTGAATAATGAAAATAAAGATGTGCTGATTGAATTTTATGCCCCTTGGTGTGGTCACTGTAAGAACCTGGAGCCCAAGTATAAAGAACTTGGCGAGAAGCTCAGCAAAGACCCAAATATCGTCATAGCCAAGATGGATGCCACAGCCAATGATGTGCCTTCTCCATATGAAGTCAGAGGTTTTCCTACCATATACTTCTCTCCAGCCAACAAGAAGCTAAATCCAAAGAAATATGAAGGTGGCCGTGAATTAAGTGATTTTATTAGCTATCTACAAAGAGAAGCTACAAACCCCCCTGTAATTCAAGAAGAAAAACCCAAGAAGAAGAAGAAGGCACAGGAGGATCTCTAAAGCAGTAGCCAAACACCACTTTGTAAAAGGACTCTTCCATCAGAGATGGGAAAACCATTGGGGAGGACTAGGACCCATATGGGAATTATTACCTCTCAGGGCCGAGAGGACAGAATGGATATAATCTGAATCCTGTTAAATTTTCTCTAAACTGTTTCTTAGCTGCACTGTTTATGGAAATACCAGGACCAGTTTATGTTTGTGGTTTTGGGAAAAATTATTTGTGTTGGGGGAAATGTTGTGGGGGTGGGGTTGAGTTGGGGGTATTTTCTAATTTTTTTTGTACATTTGGAACAGTGACAATAAATGAGACCCCTTTAAACTGTCTTATTTTCCACCAGATTGAGAACCAGATGTTCTCTACACACTATCACTGTTCAATAGAGCTTTCTTCAGTGATGGAAATGCTCTGT