Transcript asmbl_35360

Sequence
Transcript Sequence for observation asmbl_35360 of TGE0005114:
GCGGCCCTAGCGCCATTTTGTGGGAGCGAAGCGGTAGCTGGGCTGCTCCTGGATCCCTGGCTGCTCCGCGTCTCCGTGTCGGGCTTCCTAGCAGCAGCCTAGCGGAAAAATAAAAGATGTCTGAATATATTCGGGTAACCGAAGACGAGAATGATGAACCCATCGAAATACCATCAGAAGACGATGGGACAGTACTGCTTTCCACAGTTACAGCTCAGTTTCCAGGGGCCTGTGGGCTGCGCTACAGGAATCCAGTGTCTCAGTGTATGAGAGGTGTCCGGCTGGTGGAAGGAATTCTGCATGCCCCGGATGCTGGCTGGGGAAATCTGGTATATGTTGTCAACTATCCCAAAGATAACAAAAGAAAAATGGATGAGACAGATGCTTCATCAGCAGTGAAAGTGAAAAGAGCAGTTCAGAAAACATCTGATTTAATAGTGTTGGGTCTCCCATGGAAAACAACTGAACAAGATCTAAAAGAATATTTTAGTACCTTTGGAGAAGTTCTTATGGTTCAGGTCAAGAAAGATATTAAAACTGGTCATTCAAAAGGCTTTGGCTTTGTTCGATTTACGGAATATGAAACCCAGGTGAAAGTAATGTCACAGCGACATATGATAGATGGACGATGGTGTGACTGTAAACTTCCTAATTCTAAGCAAAGCCCAGATGAACCTTTGAGAAGCAGAAAGGTGTTCGTTGGGCGTTGTACGGAGGACATGACTGCTGATGAGTTGCAGCAGTTCTTCTGCCAGTATGGAGAAGTGGTAGATGTCTTCATTCCCAAACCGTTCAGGGCTTTTGCCTTTGTTACATTTGCAGATGATCAGGTTGCCCAGTCTCTTTGTGGAGAGGACTTGATCATTAAAGGAATCAGCGTACATATATCCAATGCTGAACCTAAGCACAATAGCAATAGACAGTTAGAAAGAAGTGGAAGATTCGGTGGTAATCCAGGTGGCTTTGGGAATCAGGGTGGATTTGGTAACAGTAGGGGGGGCGGAGCTGGCTTGGGAAACAATCAAGGTAGTAATATGGGTGGGGGGATGAACTTTGGTGCTTTTAGCATTAATCCAGCAATGATGGCTGCAGCCCAGGCAGCACTGCAGAGCAGCTGGGGTATGATGGGCATGCTAGCCAGTCAGCAGAATCAGTCAGGCCCATCAGGTAATAACCAAAGCCAAGGCAACATGCAGAGGGAGCCAAACCAGGCCTTTGGTTCTGGAAATAATTCTTATAGTGGTTCTAATTCAGGTGCAGCAATTGGTTGGGGATCAGCATCAAATGCAGGGTCAGGCAGTGGTTTTAATGGAGGCTTTGGCTCAAGCATGGATTCTAAACCTTCTAGCTGGGGAATGTAGACAGTGGGCGATGGTTGTATAGACTGGTGGGAATTCAAATTTTTCTAAACTCATGGTAAGTATATTGTAAAATACATATGTACTAAGAATTTTCAAAATTGGTTTGTTCAGTGTGGAGTATATTCAGCAGTATTTTTGACATTTTTCTTTAGAAAAAGAAGAAGAGCTAAAGGAATTTTATAAGTTTTGTTACATAAAGGGTTGAAATATTGAGTGTTTGAAAGTGAACTGCTGTTTGCCTGATTGGTAAACCAACACACTACAATTGATATCAAAAGGTTTCTCCTGTAATATTTTATCCCTGGACTTGTCAAGTGAATTCTTTGCATGTTCAAAATGGAAACCATTGATTAGAACTACATTGTTTTCTCCTTGTTTTAATTTGAACCCCACCGTATGGATTTTTTTCCTTAGGAAAACTCTCCGTTTTGGAGATCATGGTGTCACAGTGTTTGGTTCTTTTGTTTGTTTTTTAACACTTGTCTCCCTTCATATACAAAAGTACAATATGAAGCCTTCATTTAATCTCTGCAGTTCATCTCATTTCAAATGTTTATGGAAGAAGCACTTCATTGAAAGGAGTGCTGTAAATGCTCTGCCATAGGAATCCTTCCGCCTACATGCTTTCTCATTCAGGAATTTGTCATCACGCTGCACAGGCTGCGTCTTTGACGGTGGGTGTCCCATTTTTATCCGCTACTCTTTATTTCATGGAGTCGTATCAACGCTATGAACGCAAGGCTGTGATATGGAACCAGAAGGCTGTTTGAACTTTTGAAACCTTGTGTGGGATTGATGGTGGTGCCGAGGCATGAAAGGCGAGTATGAGCGAGAAAAGGAGAGCGCGTGCAGAGACTTGGTGGTGCATAATGGATATTTTTTAACTTGGCGCGATGTGTCTCTCAATCCTGTGGCTTTGGTGAGAGAGTGTGCAGAGAGCAATGATAGCAAATAATGTACGAATGTTTTTTGCATTCAAAGGACATCCACCTCTGTTGGAAGACTTTAAGTGAGTTTTGTTCTTAGATAACCCACGTTAGTTGAATGTGTTAAGTGAAACGATACTTGTATTTCCCCTACCCCTTTGTCAACTGCTGTGAATGCTGTATGGTGTGTGTTCTCTTCTGTTACTGACCTGTAAGTGTGGTAATGTGAACTGAAGCTGATGGGTTGAGAACATGGACTGAGCTTGTGGTGTGCTTTGCAGGAGTACTTGGAAGCAGAGTTCACCAGTGAGCTGGGGGTGTCTCAAAGAAGGGTGGAAGTTCTAATGTCTGTTAGCTACCCATAAGAATGCTGTTTGCTGCAGTTCTGTGTCCTGTGCTTGGATGCTTTTTATAAGAGTTGTCAATGTTGGAAATTCTTAAATAAAACTGATTTAAATAATATGTGTCTTTGTTTTGCAGCCCTGAATGCAAAGAATTCATAGCAGTTAATTCCCCTTTTTGACCCTTTTGAGATGGAACTTTCATAAAGTTTCTTGGCAATAGTTTATTTTGCTTCAAATAAACTTATTTGAAAAGTTGTCTCAAGTCAAATGGATTCATCACCTGTCATGCATTGACACCTGATACCCAGACTTAATTGCTATCTGTTCTTGCATTGTCCAA