Transcript asmbl_11364

Sequence
Transcript Sequence for observation asmbl_11364 of TGE0031751:
GGAAGTCTTGTGACCCCGGAAGTGACCGTCCGAGCGGCGGGCGGCGGACGACGTTCGTCATTTGGTGCGGGAGGGAGCGCGAGAGCGGCGGTCGAGCCTCCGGTGTCCCAAGCTAGAGGTAAGCATGGCAGAACAGGAACCCACTGCTGAGCAGCTTGCGCAGATAGCTGCAGAGAATGAGGAAGATGAGCACTCTGTGAACTACAAGCCTCCAGCCCAGAAGAGCATCCAGGAGATCCAGGAACTGGACAAGGACGATGAAAGCCTCCGAAAGTACAAGGAGGCCCTGCTGGGCCGAGTAGCTGTCTCTGCAGACCCCAACGTCCCCAATGTCATTGTGACTCGACTGACCTTGGTATGCAGCACTGCCCCAGGCCCTCTGGAACTGGACCTGACAGGTGATCTGGAGAGCTTCAAGAAACAGTCGTTTGTCTTGAAGGAAGGTGTGGAGTACCGGATAAAAATCTCTTTCCGGGTGAACAGAGAGATCGTGTCCGGCATGAAGTACATCCAACACACATACAGGAAAGGGGTCAAAATTGACAAGACTGACTACATGGTCGGGAGCTATGGGCCGAGGGCCGAGGAGTATGAGTTCCTGACACCCATGGAGGAGGCTCCCAAAGGCATGCTTGCTCGGGGCAGTTACAACATCAAGTCGCGCTTCACAGATGACGACAAGACTGACCACCTGTCCTGGGAGTGGAATCTCACCATCAAAAAGGAGTGGAAGGACTGAGCTCCAGCTGGGAGACGGGCAGGGCGACGGACAGACAGAAGGACCGACATGCCCCACCCTAACCCCCTACCTACCCCAAACCAAAGTGCTGACAGGACCTCCCTCACCCGTCATTCCTCCCTAGTCCACTCAGGCAGTCAGCTCTCCTGTCTGCCCCTCCTCCACCTCCTGCCCGCAGGCCCCTGTGGTCTCCAGTGTCACATTGCTGCTTCTGCCTGTGCAGTGGGGGAGGGGTTCCAGCCCAGGCCTCCAATCTGCTGTGTCCCTCCAGGTTCCCTCTGTCTTCCCTTCCTCAGGCCCTGGCTTCTAGAATGGAACAGAACACTGTCAGGGTTGTCCAGCCCACCTTGTCTCTGTCGCAGCATGGGGAAGGGCTGGGCTATCTGTCCTCTAGTCCCACCACTCCCTGGCCAGGTCATCCATCACTGTCAGTCACTGTCTAACCATGATGCCTTAACATGTGGAACGTGTGCTGGGGGCCGTCGCTAACTCTTAACTCCCTGTCTGCATGAGCATGTGCTCTCCCTGTCCTCGCCTCGTCTGCCATCCCCATCCCAGTGACCCACCCAAGGGAGGCCTGGGGTGCGCTGCTGTTGCTTCCTGCGAGCCTGGCCAGCTCTTCCCCTCCCCGTGGCCAGGGTTGGGGGTGGCTCCAGTAGCTAGGGGAGGGTCAATTGCCAAAACTCGATGCCTCCAGCCCCATCTAGGAGGCAGGGTAGGGTGCCTCATTCCTCTGCCTTCTCTGTCCCTTGTAGGCAGTACTCGGAGCCCCTGTCCCCACAGAGAGCCCCTGAGGGACAAAGCCAGCCGAGCCTTACTTGTCTCACCTGGGCCACGTGGCCTGAACCTCGTGCCTGGCCTGTCAGTATTTATTGCCTCCATTTGGGCCAGCTGGCCTGATGCCTCTGCCCTGGTTCTTGGTGCCACCATCCCTGGGCCGACCCTCCCTGGACCCAGCCAGGACAAATGTGGGACCAAGTTCACACAGTTGGGAGCTGTCTCCTGTGCCTCCCCTCCCTATCCCCAGTCCCTGTGTGGTGTCTGCCAGGCCCAGCCTCAACAGGCAGAGGAGCCTGTCCCTGCTTCTCTTCTGACTGGGAAATAAACACCCCTGAAGGAGTCTGGG