Transcript asmbl_19630

Sequence
Transcript Sequence for observation asmbl_19630 of TGE0000522:
CGGGCGGCTCGGGGCACCGAGGGCGCATGCGCGAGGGCAGCGACCGCGACTCAGTCTCCGCAGAGCCCGGGCGGGAGTAGCTGGTGGACCCCGTTGAGCTGCCGAACTTCCGGGACTCCCCCGCGACCCCTTCCCAGCTTCCCGTCCGCTCCGCCGCAGCGATTGTCTCGGTGGGTTGATTCGGCACAAACCGCCCGACCCAGGGGCCGGTGCGCGTGTGGAAGGGGAAGCACTCCCCTCGTGGTCGCCTGGAGGTGCGCTGGAGGAGGGGGTGACATAACCAGGGACTCGAGGTCCGCCGTGGGAATGATCCACGAACTGCTCTTGGCTCTGAGCGGGTACCCTGGGTCCATTTTCACCTGGAACAAGCGGAGTGGCCTGCAGGTATCGCAGGACTTCCCTTTCCTCCACCCCAGTGAGACCAGTGTCCTGAATCGACTCTGCCGGCTCGGCACAGACTATATTCGCTTCACTGAGTTCATTGAACAGTACACGGGCCATGTGCAACAGCAGGATCACCATCCATCTCAACAGGGCCAAGGTGGGTTACATGGAATCTACCTGCGGGCCTTCTGCACAGGGCTGGATTCTGTTTTGCAGCCTTATCGCCAAGCACTGCTTGATTTGGAACAAGAGTTCCTGGGTGATCCCCATCTCTCCATATCACATGTCAACTACTTCCTAGACCAGTTCCAGCTTCTTTTTCCCTCTGTGATGGTTGTAGTAGAACAAATTAAAAGTCAAAAGATTCATGGTTGTCAAATCCTGGAAACAGTCTACAAACACAGCTGTGGGGGGTTGCCTCCTGTTCGAAGTGCACTGGAAAAAATCCTGGCCGTTTGTCATGGGGTCATGTATAAACAGCTCTCAGCCTGGATGCTCCATGGACTCCTCTTGGACCAGCATGAAGAATTCTTTATCAAACAGGGGCCATCTTCTGGTAATGTCAGTGCCCAGCCAGAAGAGGACGAGGAGGATCTGGGCATTGGGGGACTGACAGGAAAACAACTGAGAGAACTGCAGGACTTGCGCCTGATTGAGGAAGAGAACATGCTGGCACCATCTCTGAAGCAGTTTTCCCTACGAGTGGAGATTTTGCCATCCTACATTCCAGTGAGGGTTGCTGAAAAAATCCTATTTGTTGGAGAATCTGTCCAGATGTTTGAGAATCAAAATGTGAACCTGACTAGAAAAGGATCCATTTTGAAAAACCAGGAAGACACTTTTGCTGCAGAGCTGCACCGTCTCAAGCAGCAGCCACTCTTCAGCTTGGTGGACTTTGAACAGGTGGTGGATCGCATTCGCAGCACTGTGGCTGAGCATCTCTGGAAGTTGATGGTAGAAGAATCCGATTTACTGGGTCAGCTGAAGATCATTAAAGACTTTTACCTTCTGGGACGTGGAGAACTGTTTCAGGCCTTCATTGACACAGCTCAACACATGTTGAAAACACCACCCACTGCAGTAACTGAGCATGATGTGAATGTGGCCTTTCAACAGTCAGCACACAAGGTATTGCTAGATGATGACAACCTTCTCCCTCTGTTGCACTTGACAATCGAGTATCACGGAAAGGAGCACAAAGATGCTACTCAGGCAAGAGAAGGGCCTTCTCGGGAAACTTCTCCCCGGGAAGCCCCTGCATCTGGCTGGGCAGCCCTAGGTCTTTCCTACAAAGTACAGTGGCCACTACATATTCTCTTCACCCCAGCTGTCCTGGAAAAGTACAATGTTGTTTTTAAGTACTTACTGAGTGTGCGCCGGGTGCAAGCTGAGCTGCAGCACTGCTGGGCCCTACAAATGCAGCGCAAGCACCTCAAGTCGAACCAGACTGATGCAATCAAGTGGCGCCTAAGAAATCACATGGCATTTTTGGTGGATAATCTTCAGTACTATCTCCAGGTAGATGTGTTGGAGTCTCAGTTCTCCCAGCTGCTTCATCAGATCAATTCTACCCGAGACTTTGAAAGCATCCGATTGGCTCATGACCACTTCCTGAGCAATTTGCTGGCTCAATCCTTTATCCTATTGAAACCTGTGTTTCACTGCCTGAATGAAATCCTAGATCTCTGTCACAGTTTTTGTTCGCTGGTCAGTCAGAACCTAGGCCCACTGGATGAGCGTGGAGCCGCCCAGCTGAGCATTCTCGTGAAGGGCTTTAGCCGCCAGTCTTCACTCCTGTTCAAGATTCTCTCCAGTGTTCGGAATCATCAGATCAACTCAGATTTGGCTCAACTACTGTTACGACTAGATTATAACAAATACTATACCCAGGCTGGTGGAACTCTGGGCAGTTTCGGGATGTGAAAATTTCTGGCTCATAAATTGAAATAACAGCCACGTTCCCAAGGTTGTAACAGAAGATTCAAAACATCCCATTCTAGCCACACACAAATAAATATCTGCGGCTTAGTGATAGGACTCTACCTTTTCTCCTAGAAGCAGTTACTGAACATCCAGGAGTACAACTCCTTCCCATCATTCCCATGTGGAAGGGTCTCTCCCATCAAGGAGAACATGTGGCATCTCTGATCCTTTACATTGAGAACATTTGTTGGATATGTTCATTTATTCAATAGTCATTTATTGAGCACCTACTACGTACCTTGGTACTGTTCAAGCTGTGGGAGATACAGCGGTAAACAAACAATATAGAGCAGAAAGTTAAATATTTTATGGTTCATATGTGAAAAAGTAATTATGTTTATAAATAGACTAACTGCTGGATGTTACCACCAAGTAAGAAAGCAACAGGTAAGATAGGCTTTCTCTCTCCCTATACCAAGTAATTTATACCTACACAGATTGGGCAATTCTAGCTAATGAAAATATACTTAAAAGTATTTCTTAGGCCGGGCATGGTGGCTCACACCTGTAA