Transcript asmbl_800

Sequence
Transcript Sequence for observation asmbl_800 of TGE0003178:
CTTCGCCGCGCCGCTGCCGCTCTCCAACGCCAGCGCCGCCTCTCGCTTGCCGAGCTCCAGCCGAAGGAGAAGGGGGGTAAGTAAGGAGGTGTCCTTACCATGGCTCGTACAAAGCAGACTGCCCGCAAATCCACCGGTGGTAAAGCACCCAGGAAACAACTGGCTACAAAAGCCGCTCGCAAGAGTGCGCCCTCTACTGGAGGGGTGAAGAAACCTCATCGTTACAGGCCTGGTACTGTGGCCCTCCGTGAAATCAGACGCTATCAGAAGTCCACTGAACTTCTGATCCGCAAGCTCCCCTTTCAGCGTCTGGTGCGAGAAATTGCTCAGGACTTCAAAACAGATCTGCGCTTCCAGAGTGCAGCTATTGGTGCTTTGCAGGAGGCAAGTGAGGCCTATCTGGTTGGCCTTTTTGAAGATACCAATCTGTGTGCTATCCATGCCAAACGTGTAACAATTATGCCAAAAGATATCCAGCTAGCACGCCGCATACGCGGAGAACGTGCTTAAGAGTCCACTATGAGGGGAAACATTTCATTCTCAAAAAAATTTTTTTTCCTCTTCTTCCTGTTATCAGTAGTTCTGAATGTTAGATATTTTTTCCATGGGGTCAAAGGTACCTAAGTATATGATTGCGAGTGGAAACATAGGGGACAGAATCAGGTATTGGCGTTTCTCCACGTTCATTTGTGTGTGAATTTTTAATATAAATGCAAGATGGAAAGCATTAATGCAAGCAAAATGTTTCAGTGAACACATTTCAACAGTTCAACTTTATAACAATTATAAATAAACCTGTTAAAATTTTCTGGACAATGCCAGCATTTGGATTTTTTTAAAATAAGTAAATTTCTTATTGACGGCAACTAAATGGTGTTTGTAGCATTTTTATCACACAGTAGATTCCATCCATTCACTATACTTTTCTAACTGAGTTGTCCTACATACAAGTACATGTTTTTAATGTTGTCAGTCTTCTGTGCTGTTCCTGTAAGTTTGCTATTAAAATACATTAAACTATA