Transcript asmbl_54425

Sequence
Transcript Sequence for observation asmbl_54425 of TGE0003105:
CGCGACGCCATTTGCCACTGCCGAGCGTGGGCACGGGAGGCTCTCGCAAGCACGGGTGACCAGCCTCTCCTGAGCACGCTTCCCGACCTCCCGCACGGTCTTCGTGGCGCGCACTTCTCGGCGTTGCCCGTCGGAGTCACCGCAGTTCCTGCCGCCAGCCTGAGTGCGGTCCCACACGCTGCCAGCCAGTCTTTGCGGCCATGCCCAAGAATAAAGGAAAAGGAGGCAAAAACCGGCGTAGAGGCAAAAATGAGAATGAATCTGAAAAGCGAGAGCTTGTGTTCAAGGAGGATGGGCAAGAATATGCTCAAGTAATCAAAATGTTGGGAAACGGACGATTAGAAGCCATGTGTTTTGATGGTGTAAAGAGACTGTGCCACATCAGAGGGAAATTGAGAAAAAAGGTTTGGATAAATACCTCAGATATCATATTGGTGGGGCTACGAGATTACCAGGACAACAAAGCCGATGTCATTTTAAAATACAACGCAGATGAAGCTAGAAGTCTCAAGGCCTATGGCGAGCTTCCAGAGCATGCTAAAATCAATGAAACTGATACATTTGGTCCTGGAGATGATGATGAAATTCAGTTTGATGACATTGGGGATGATGATGAAGACATCGATGATATCTAAAGCGAACTCAACATTTTACATTCCAGTCTTCCGGAAGATTGTCCTTCAAGTTTGGAATCTGGCCATAGACCTCAAAGAAAAATTTTCACTATCATCTTAATTGTAATTTGTTGAGGCAGATTTGATATTACAGTCTTTGAAAAACTGTTAACTGATACGCTAAGTCCACTTTGTTGATTCGATTCAATGGTCCTTAAGACTGTTTAAGACAAAAAGCCTTTCCTACTTTGACCCCTTCCAGTAAGTAAATGGGTGTTTTGAATAAACCATTTGCCTTGTGCTCAGTATAAAGTATGACTAAGCCCTGCCTTTGCATAGCTGTTGACTGGACAGTCTTTGTGTATATTCCAGTTGCCCAGAGATTTTGATACACATGGAGGCAGAAATCTGTGTTTTGTTTTT