Transcript asmbl_19563

Sequence
Transcript Sequence for observation asmbl_19563 of TGE0000518:
CCTGGATTGGTGGAGCTAAGAGCTGGCTCAGTTTCAGCGCTGGCTCTTCGTGCATGGCAGAGATGGCGACTGCGACTCGGCTGCTGGGGTGGCGTGTGGCGAGCTGGAGGCTGCGGCCGCCGCTTGCCGGCTTCGTTTCCCAGCGGGCCCACTCGCTTTTGCCCGTGGACGATGCAATCAATGGGCTAAGCGAGGAGCAGAGGCAGCTTCGTCAGACCATGGCTAAGTTCCTTCAGGAGCACCTGGCCCCCAAGGCCCAGGAGATCGATCGCAGCAATGAGTTCAAGAACCTGCGAGAATTTTGGAAGCAGCTGGGGAACCTGGGCGTATTGGGCATCACAGCCCCTGTTCAGTATGGCGGCTCCGGCCTGGGCTACCTGGAGCATGTGCTGGTGATGGAGGAGATATCCCGAGCTTCCGGAGCAGTGGGGCTCAGTTACGGTGCCCACTCCAACCTCTGCATCAACCAGCTTGTACGCAATGGGAATGAGGCCCAGAAAGAGAAGTATCTCCCGAAGCTGATCAGTGGTGAGTACATCGGAGCCCTGGCCATGAGTGAGCCCAATGCAGGCTCTGATGTTGTCTCTATGAAGCTCAAAGCGGAAAAGAAAGGAAATCACTACATCCTGAATGGCAACAAGTTCTGGATCACTAATGGCCCTGATGCTGACGTCCTGATTGTCTATGCCAAGACAGATCTGGCTGCTGTGCCAGCTTCTCGGGGCATCACAGCCTTCATTGTGGAGAAGGGTATGCCTGGCTTTAGCACCTCTAAGAAGCTGGACAAGCTGGGGATGAGGGGCTCTAACACCTGTGAGCTAATCTTTGAAGACTGCAAGATTCCTGCTGCCAACATCCTGGGCCATGAGAATAAGGGTGTCTACGTGCTGATGAGTGGGCTGGACCTGGAGCGGCTGGTGCTGGCCGGGGGGCCTCTTGGGCTCATGCAAGCGGTCCTGGACCACACCATTCCCTACCTGCACGTGAGGGAAGCCTTTGGCCAGAAGATCGGCCACTTCCAGTTGATGCAGGGGAAGATGGCTGACATGTACACCCGCCTCATGGCGTGTCGGCAGTATGTCTACAATGTCGCCAAGGCCTGCGATGAGGGCCATTGCACTGCTAAGGACTGTGCAGGTGTGATTCTTTACTCAGCTGAGTGTGCCACACAGGTAGCCCTGGACGGCATTCAGTGTTTTGGTGGCAATGGCTACATCAATGACTTTCCCATGGGCCGCTTTCTTCGAGATGCCAAGCTGTATGAGATAGGGGCTGGGACCAGCGAGGTGAGGCGGCTGGTCATCGGCAGAGCCTTCAATGCAGACTTTCACTAGTCCTGAGACCCTTCGCCCCCTTTTCCTGCACCTAGTGGCCTTTCTTGGGAAGTAGAGATGTGGCGGCTTTCCCACCCTGCCCACAGCAGGCCCTCCTGCCCAGCTGCTCTTGTCAGCCCTCTGGCCTCTGGATGAGGTTGAGTTCTCCACAACAGCTCCCAAGCATCATGGGCCTCGCAGCCGGGCCTGTGCCACGGCTAGTGTTGTGTGATTTAAAATGGACTCAGCAGGAAGCATATTGTCTGGGGATTGTTGGGACAGGTTTTGGTGACTCTGTGCCCTTGCTCTCTAACTTCTGAGCCCACCTCCCAGGGGTAGGCACCTGGGGGCATGCAGGTACCCACCTCTTTCTCTTGGGTGAGGCTCTGGCAAGGAGATCTCTCTGCTCAAGCACAGCAGAATCATGGCCCCTCTCCATGAATTGGAACTTGGTACAGGTTAAGTATCCCTAATCCTGAAATCTGAAACACTTGTGGTTCCAAGCATTTTGGATAAGGCAAATTCAACTTTCAGTCTCTTTTCTGGGGGAAAAAAATAATAAACCTAGCCTAGCCAGGCGTGGTGGCTCATGCTTGTAATCCCAGCACTT