Transcript asmbl_34769

Sequence
Transcript Sequence for observation asmbl_34769 of TGE0005055:
CGGAGCATGGGGGACACACCCGCCTGGGTGGGACTCCCAGAACCACTGCCCCCTGCCATCCCAGCTGCTTCCTTGCTCTTGCTGTACGTCCACTCACCGCCCTTTCTCCCACCGCTTATGCCTGGGCTAGTGACCCAGGGAGGAGCGGCCCCGCGCTCCAGAGCCCGCAAGTCCAGGCTGCGGGCGAGGCCGGCGGAGGTTAAGCTCTAGGTTCGGTGGCAAAGACTCACACTGCATCAGCGCAGGCCGGAAACTGGGGTGGGCCGGGCCTGAGAGGGGACGCTGAGCCTCCATCTTCTCGGGCTCCTATACCCCCTCCCCCGCCCATCTCCGGTGCCAGAAACCGGCTGAGTCACCGAGCCTCAGCGCGCCAGGCGGAGAAGAGAGGGAGGGCCGGGACCGCGGGATGTGGTCAGAGTCACGTCCTAAGGGGATGGGGGAGGGCTCGCGTGCTGGCTGCACTGTCCCCGCCCAAGAGCCGCCTACCGGCTTCGCCTTTCGGGGGCGGCCGCTCCCACAATTCATCGCCTGCAATTGGACACCAGGACGCCTCGGGCTCCAGTAAAGGAAAAAAACCCGGCAGAGGGCGGAGCTCTGCCCTTATATGGCTTGATACCGCCTCCTTCCCGCCCCCTGTGCCGCCCCCTCGGGAGCTGAATAGGCCGCGTTCCGCTTGGAACGCGCCGCAGAACCGGGGTGCTGGTGACGACCGCTGCGTTCGCTCCCTCAGTCCACTCGCCAGCCCGCTGCCCTCCACCGCTGCACCGGGCAAACCAGCCCCTCTACTCTGCCAGGAACTGACAGGCACCATGCCCTACCAATACCCAGCGCTGACCCCGGAGCAGAAGAAAGAGCTGTCTGACATTGCTCACCGCATTGTGGCTCCGGGCAAAGGCATCTTGGCTGCAGATGAGTCCACTGGGAGCATTGCCAAGCGGCTGCAGTCCATTGGCACTGAGAACACCGAGGAGAACCGTCGCTTCTACCGCCAGCTGCTGCTGACTGCCGATGACCGTGTGAATCCCTGCATTGGGGGTGTCATCCTCTTCCATGAGACGCTTTATCAGAAGGCAGATGATGGGCGTCCCTTCCCCCAAGTTATCAAATCCAAGGGCGGTGTTGTGGGCATCAAGGTAGACAAGGGTGTGGTACCCCTGGCAGGAACAAATGGCGAGACTACCACCCAAGGATTGGATGGGCTGTCTGAGCGCTGTGCTCAGTACAAGAAGGATGGAGCTGACTTTGCCAAGTGGCGCTGTGTGCTGAAGATTGGGGAACACACTCCCTCAGCCCTTGCCATCATGGAAAATGCCAATGTTTTGGCCCGTTATGCCAGCATCTGCCAGCAGAATGGCATTGTGCCCATCGTGGAGCCTGAGATCCTCCCTGATGGGGACCACGACCTGAAGCGCTGTCAGTATGTAACTGAAAAGGTGCTGGCTGCTGTCTACAAGGCTCTGAGTGACCATCACATCTACCTGGAAGGCACCTTGCTGAAGCCTAATATGGTCACCCCAGGCCATGCCTGCACCCAGAAATTTTCTAACGAGGAGATTGCCATGGCAACTGTCACAGCGCTGCGCCGCACAGTGCCCCCTGCTGTCACTGGGATCACCTTCTTATCTGGAGGTCAGAGTGAGGAGGAGGCATCCATCAACCTCAATGCAATCAACAAGTGCCCCCTGCTGAAGCCTTGGGCCCTGACCTTTTCCTATGGCCGAGCCCTGCAGGCCTCTGCCCTGAAGGCCTGGGGTGGAAAGAAGGAGAACCTGAAGGCTGCCCAGGAGGAATATGTCAAGCGAGCACTGGCCAACAGCCTTGCCTGCCAAGGAAAGTACACCCCAAGTGGTCAGGCCGGGGCTGCAGCCAGCCAGTCCCTCTTCATATCTAACCATGCCTACTAAGCGGAGGTGTTCCAAGGCCGCCTCAACACTCCAGGTCCTGCCCGCTTCCACACACCTGAAGAGGGGGCCTCATCCGGGGCTCCAGGCTCCTCTTTCCCATCACTCTTACCTCCCTTGTGACATTGGTGCGTGGTGTTGTCTGTGAATGCTAACTCCATCGCCCTTTCCAGCCCACTGCCAATAAACAACTATTTAAGGGGG