Transcript asmbl_19562

Sequence
Transcript Sequence for observation asmbl_19562 of TGE0000518:
CCTGGATTGGTGGAGCTAAGAGCTGGCTCAGTTTCAGCGCTGGCTCTTCGTGCATGGCAGAGATGGCGACTGCGACTCGGCTGCTGGGGTGGCGTGTGGCGAGCTGGAGGCTGCGGCCGCCGCTTGCCGGCTTCGTTTCCCAGCGGGCCCACTCGCTTTTGCCCGTGGACGATGCAATCAATGGGCTAAGCGAGGAGCAGAGGCAGCTTCGTCAGACCATGGCTAAGTTCCTTCAGGAGCACCTGGCCCCCAAGGCCCAGGAGATCGATCGCAGCAATGAGTTCAAGAACCTGCGAGAATTTTGGAAGCAGCTGGGGAACCTGGGCGTATTGGGCATCACAGCCCCTGTTCAGTATGGCGGCTCCGGCCTGGGCTACCTGGAGCATGTGCTGGTGATGGAGGAGATATCCCGAGCTTCCGGAGCAGTGGGGCTCAGTTACGGTGCCCACTCCAACCTCTGCATCAACCAGCTTGTACGCAATGGGAATGAGGCCCAGAAAGAGAAGTATCTCCCGAAGCTGATCAGTGGTGAGTACATCGGAGCCCTGGCCATGAGTGAGCCCAATGCAGGCTCTGATGTTGTCTCTATGAAGCTCAAAGCGGAAAAGAAAGGAAATCACTACATCCTGAATGGCAACAAGTTCTGGATCACTAATGGCCCTGATGCTGACGTCCTGATTGTCTATGCCAAGACAGATCTGGCTGCTGTGCCAGCTTCTCGGGGCATCACAGCCTTCATTGTGGAGAAGGGTATGCCTGGCTTTAGCACCTCTAAGAAGCTGGACAAGCTGGGGATGAGGGGCTCTAACACCTGTGAGCTAATCTTTGAAGACTGCAAGATTCCTGCTGCCAACATCCTGGGCCATGAGAATAAGGGTGTCTACGTGCTGATGAGTGGGCTGGACCTGGAGCGGCTGGTGCTGGCCGGGGGGCCTCTTGGGCTCATGCAAGCGGTCCTGGACCACACCATTCCCTACCTGCACGTGAGGGAAGCCTTTGGCCAGAAGATCGGCCACTTCCAGTTGATGCAGGGGAAGATGGCTGACATGTACACCCGCCTCATGGCGTGTCGGCAGTATGTCTACAATGTCGCCAAGGCCTGCGATGAGGGCCATTGCACTGCTAAGGACTGTGCAGGTGTGATTCTTTACTCAGCTGAGTGTGCCACACAGGTAGCCCTGGACGGCATTCAGTGTTTTGGTGGCAATGGCTACATCAATGACTTTCCCATGGGCCGCTTTCTTCGAGATGCCAAGCTGTATGAGATAGGGGCTGGGACCAGCGAGGTGAGGCGGCTGGTCATCGGCAGAGCCTTCAATGCAGACTTTCACTAGTCCTGAGACCCTTCGCCCCCTTTTCCTGCACCTAGTGGCCTTTCTTGGGAAGTAGAGATGTGGCGGCTTTCCCACCCTGCCCACAGCAGGCCCTCCTGCCCAGCTGCTCTTGTCAGCCCTCTGGCCTCTGGATGAGGTTGAGTTCTCCACAACAGCTCCCAAGCATCATGGGCCTCGCAGCCGGGCCTGTGCCACGGCTAGTGTTGTGTGATTTAAAATGGACTCAGCAGGAAGCATATTGTCTGGGGATTGTTGGGACAGGTTTTGGTGACTCTGTGCCCTTGCTCTCTAACTTCTGAGCCCACCTCCCAGGGTAGGCACCTGGGGGCATGCAGGTACCCACCTCTTTCTCTTGGGTGAGGCTCTGGCAAGGAGATCTCTCTGCTCAAGCACAGCAGAATCATGGCCCCTCTCCATGAATTGGAACTTGGTACAGGTTAAGTATCCCTAATCCTGAAATCTGAAACACTTGTGGTTCCAAGCATTTTGGATAAGGCAAATTCAACTTTCAGTCTCTTTTCTGGGGGAAAAAAATAATAAACCTAGCCTAGCCAGGCGTGGTGGCTCATGCTTGTAATCCCAGCACTT