Transcript asmbl_53574

Sequence
Transcript Sequence for observation asmbl_53574 of TGE0005218:
GACCCCTTTGCTGATGCAACTAAGGGCGACGACTTACTCCCGGCAGGGACTGAGGACTACATTCATATAAGGATCCAGCAGCGCAACGGCAGGAAGACGCTGACCACTGTGCAGGGCATTGCGGACGATTATGACAAAAAGAAACTTGTGAAAGCTTTCAAAAAGAAATTTGCCTGCAATGGAACTGTGATTGAACACCCTGAGTACGGAGAGGTTATTCAGCTTCAAGGGGACCAAAGGAAGAACATCTGCCAGTTTCTTCTGGAGGTTGGCATCGTCAAGGAGGAGCAGCTGAAGGTTCACGGGTTCTAAGATGAACCCAAGCGTGGCGAGTTTCTTAAATGGTTTTGTTCTCTAACTCAGTTTGGCTGCCTCGGGAGATGATTCTTTACAGTAAACGACAGACTTTGCGTTTATTTAATCATTCAGACTTCCACTCACACCTGCATGGCTACAGAAAACACGGGGTATGTAGGCTCCTGAGTCATAAGGAAATCGCGGTGAGATGGGAACGAAGCCCGAGTCCGTCCTAACATGTTTCCAATGGAAAAGGTTTTGTTGTGAGTGTTTGTTGTTAGTTTTATTTTCACTTGACTGTTAAATGTTTTTGTTGTTGTATTAAACCATGTATGTTGCGGCTTAACAATAAAAAGAAAGTGTG