Transcript asmbl_19560

Sequence
Transcript Sequence for observation asmbl_19560 of TGE0000517:
GGAGGGGCGTGGCCACGTCGACCGCGCGGGACCGTTAAATTTGAAACTTGGCGGCTAGGGGTGTGGGCTTGAGGTGGCCGGTTTGTTAGGGAGTCGTGTACGTGCCTTGGTCGCTTCTGTAGCTCCGAGGGCAGGTTGCGGAAGAAAGCCCAGGCGGTCTGTGGCCCAGAGGAAAGGCCTGCAGCAGGACGAGGACCTGAGCCAGGAATGCAGGATGGCGGCGGTGAAGAAGGAAGGGGGTGCTCTGAGTGAAGCCATGTCCCTGGAGGGAGATGAATGGGAACTGAGTAAAGAAAATGTACAACCTTTAAGGCAAGGGCGGATCATGTCCACGCTTCAGGGAGCACTGGCACAAGAATCTGCCTGTAACAATACTCTTCAGCAGCAGAAACGGGCATTTGAATATGAAATTCGATTTTACACTGGAAATGACCCTCTGGATGTTTGGGATAGGTATATCAGCTGGACAGAGCAGAACTATCCTCAAGGTGGGAAGGAGAGTAATATGTCAACGTTATTAGAAAGAGCTGTAGAAGCACTACAAGGAGAAAAACGATATTATAGTGATCCTCGATTTCTCAATCTCTGGCTTAAATTAGGGCGTTTATGCAATGAGCCTTTGGATATGTACAGTTACTTGCACAACCAAGGGATTGGTGTTTCACTTGCTCAGTTCTATATCTCATGGGCAGAAGAATATGAAGCTAGAGAAAACTTTAGGAAAGCAGATGCGATATTTCAGGAAGGGATTCAACAGAAGGCTGAACCACTAGAAAGACTACAGTCCCAGCACCGACAATTCCAAGCTCGAGTGTCTCGGCAAACTCTGTTGGCACTTGAGAAAGAAGAAGAGGAGGAAGTTTTTGAGTCTTCTGTACCACAACGAAGCACACTAGCTGAACTAAAGAGCAAAGGGAAAAAGACAGCAAGAGCTCCAATCATCCGTGTAGGAGGTGCTCTCAAGGCTCCAAGCCAGAACAGAGGACTCCAAAATCCATTTCCTCAACAGATGCAAAATAATAGTAGAATTACTGTTTTTGATGAAAATGCTGATGAGGCTTCTACAGCAGAGTTGTCTAAGCCTACAGTCCAGCCATGGATAGCACCCCCCATGCCCAGGGCCAAAGAGAATGAGCTGCAAGCAGGCCCTTGGAACACAGGCAGGTCCTTGGAACACAGGCCTCGTGGCAATACAGCTTCACTGATAGCTGTACCCGCTGTGCTTCCCAGTTTCACTCCATATGTGGAAGAGACTGCACGACAGCCAGTTATGACACCATGTAAAATTGAACCTAGTATAAACCACATCCTAAGCACCAGAAAGCCTGGAAAGGAAGAAGGAGATCCTCTACAAAGGGTTCAGAGCCATCAGCAAGCGTCTGAGGAGAAGAAAGAGAAGATGATGTATTGTAAGGAGAAGATTTATGCAGGAGTAGGGGAATTCTCCTTTGAAGAAATTCGGGCTGAAGTTTTCCGGAAGAAATTAAAAGAGCAAAGGGAAGCCGAGCTATTGACCAGTGCAGAGAAGAGAGCAGAAATGCAGAAACAGATTGAAGAGATGGAGAAGAAGCTAAAAGAAATCCAAACTACTCAGCAAGAAAGAACAGGTGATCAGCAAGAAGAGACGATGCCTACAAAGGAGACAACTAAACTGCAAATTGCTTCCGAGTCTCAGAAAATACCAGGAATGACTCTATCCAGTTCTGTTTGTCAAGTAAACTGTTGTGCCAGAGAAACTTCACTTGCGGAGAACATTTGGCAGGAACAACCTCATTCTAAAGGTCCCAGTGTACCTTTCTCCATTTTTGATGAGTTTCTTCTTTCAGAAAAGAAGAATAAAAGTCCTCCTGCAGATCCCCCACGAGTTTTAGCTCAACGAAGACCCCTTGCAGTTCTCAAAACCTCAGAAAGCATCACCTCAAATGAAGATGTGTCTCCAGATGTTTGTGATGAATTTACAGGAATTGAACCCTTGAGCGAGGATGCCATTATCACAGGCTTCAGAAATGTAACAATTTGTCCTAACCCAGAAGACACTTGTGACTTTGCCAGAGCAGCTCGTTTTGTATCCACTCCTTTTCATGAGATAATGTCCTTGAAGGATCTCCCTTCTGATCCTGAGAGACTGTTACCGGAAGAAGATCTAGATGTAAAGACCTCTGAGGACCAGCAGACAGCTTGTGGCACTATCTACAGTCAGACTCTCAGCATCAAGAAGCTGAGCCCAATTATTGAAGACAGTCGTGAAGCCACACACTCCTCTGGCTTCTCTGGTTCTTCTGCCTCGGTTGCAAGCACCTCCTCCATCAAATGTCTTCAAATTCCTGAGAAACTAGAACTTACTAATGAGACTTCAGAAAACCCTACTCAGTCACCATGGTGTTCACAGTATCGCAGACAGCTACTGAAGTCCCTACCAGAGTTAAGTGCCTCTGCAGAGTTGTGTATAGAAGACAGACCAATGCCTAAGTTGGAAATTGAGAAGGAAATTGAATTAGGTAATGAGGATTACTGCATTAAACGAGAATACCTAATATGTGAAGATTACAAGTTATTCTGGGTGGCGCCAAGAAACTCTGCAGAATTAACAGTAATAAAGGTATCTTCTCAACCTGTCCCATGGGACTTTTATATCAACCTCAAGTTAAAGGAACGTTTAAATGAAGATTTTGATCATTTTTGCAGCTGTTATCAATATCAAGATGGCTGTATTGTTTGGCACCAATATATAAACTGCTTCACCCTTCAGGATCTTCTCCAACACAGTGAATATATTACCCATGAAATAACAGTGTTGATTATTTATAACCTTTTGACAATAGTGGAGATGCTACACAAAGCAGAAATAGTCCATGGTGACTTGAGTCCAAGGTGTCTGATTCTCAGAAACAGAATCCACGATCCCTATGATTGTAACAAGAACAATCAAGCTTTGAAGATAGTGGACTTTTCCTACAGTGTTGACCTTAGGGTGCAGCTGGATGTTTTTACCCTCAGCGGCTTTCGGACTGTACAGATCCTGGAAGGACAAAAGATCCTGGCTAACTGTTCTTCTCCCTACCAGGTAGACCTGTTTGGTATAGCAGATTTAGCACATTTACTATTGTTCAAGGAACACCTACAGGTCTTCTGGGATGGGTCCTTCTGGAAACTTAGCCAAAATATTTCTGAGCTAAAAGATGGTGAATTGTGGAATAAATTCTTTGTGCGGATTCTGAATGCCAATGATGAGGCCACAGTGTCTGTTCTTGGGGAGCTTGCAGCAGAAATGAATGGGGTTTTTGACACTACATTCCAAAGTCACCTGAACAAAGCCTTATGGAAGGTAGGGAAGTTAACTAGTCCTGGGGCTTTGCTCTTTCAGTGAGCTAGGCAATCAAGTCTCACAGATTGCTGCCTCAGAGCAATGGTTGTATTGTGGAACACTGAAACTGTATGTGCTGTAATTTAATTTAGGACACATTTAGATGCACTACCATTGCTGTTCTACTTTTTGGTACAGGTATATTTTGACGTCACTGATATTTTTTATACAGTGATATACTTACTCATGGCCTTGTCTAACTTTTGTGAAGAACTATTTTATTCTAAACAGACTCATTACAAATGGTTACCTTGTTATTTAACCCATTTGTCTCTACTTTTCCCTGTACTTTTCCCATTTGTAATTTGTAAAATGTTCTCTTATGATCACCATGTATTTTGTAAATAATAAAATAGTATCTGTTAAA