Transcript asmbl_19552

Sequence
Transcript Sequence for observation asmbl_19552 of TGE0000516:
AGGGGGGCGTCAATGACAATTTCCAGGGGGTGCTGCAGAATGTGAGGTTTGTCTTTGGAACCACACCAGAAGACATCCTCAGGAACAAAGGCTGCTCCAGCTCTACCAGTGTCCTCCTCACCCTTGACAACAACGTGGTGAATGGTTCCAGCCCTGCCATCCGCACTAACTACATTGGCCACAAGACAAAGGACTTGCAAGCCATCTGCGGCATCTCCTGTGATGAGCTGTCCAGCATGGTCCTGGAACTCAGGGGCCTGCGCACCATTGTGACCACGCTGCAGGACAGCATCCGCAAAGTGACTGAAGAGAACAAAGAGTTGGCCAATGAGCTGAGGCGGCCTCCCCTATGCTATCACAACGGAGTTCAGTACAGAAATAACGAGGAATGGACTGTTGATAGCTGCACTGAGTGTCACTGTCAGAACTCAGTTACCATCTGCAAAAAGGTGTCCTGCCCCATCATGCCCTGCTCCAATGCCACAGTTCCTGATGGAGAATGCTGTCCTCGCTGTTGGCCCAGCGACTCTGCGGACGATGGCTGGTCTCCATGGTCCGAGTGGACCTCCTGTTCTACGAGCTGTGGCAATGGAATTCAGCAGCGCGGCCGCTCCTGCGATAGCCTCAACAACCGATGTGAGGGCTCCTCGGTCCAGACACGGACCTGCCACATTCAGGAGTGTGACAAGAGATTTAAACAGGATGGTGGCTGGAGCCACTGGTCCCCGTGGTCATCTTGTTCTGTGACATGTGGTGATGGTGTGATCACAAGGATCCGGCTCTGCAACTCTCCCAGCCCCCAGATGAACGGGAAACCCTGTGAAGGCGAAGCGCGGGAGACCAAAGCCTGCAAGAAAGACGCCTGCCCCATCAATGGAGGCTGGGGTCCTTGGTCACCATGGGACATCTGTTCTGTCACCTGTGGAGGAGGGGTACAGAAACGTAGTCGTCTCTGCAACAACCCCACACCCCAGTTTGGAGGCAAGGACTGCGTTGGTGATGTAACAGAAAACCAGATCTGCAACAAGCAGGACTGTCCAATTGATGGATGCCTGTCCAATCCCTGCTTTGCCGGCGTGAAGTGTACTAGCTACCCTGATGGCAGCTGGAAATGTGGTGCTTGTCCCCCTGGTTACAGTGGAAATGGCATCCAGTGCACAGATGTTGATGAGTGCAAAGAAGTGCCTGATGCCTGCTTCAACCACAATGGAGAGCACCGGTGTGAGAACACGGACCCCGGCTACAACTGCCTGCCCTGCCCCCCACGCTTCACCGGCTCACAGCCCTTCGGCCAGGGTGTCGAACATGCCACGGCCAACAAACAGGTGTGCAAGCCCCGTAACCCCTGCACGGATGGGACCCACGACTGCAACAAGAACGCCAAGTGCAACTACCTGGGCCACTATAGCGACCCCATGTACCGCTGCGAGTGCAAGCCTGGCTACGCTGGCAATGGCATCATCTGCGGGGAGGACACAGACCTGGATGGCTGGCCCAATGAGAACCTGGTGTGCGTGGCCAATGCGACTTACCACTGCAAAAAGGATAATTGCCCCAACCTTCCCAACTCAGGGCAGGAAGACTATGACAAGGATGGAATTGGTGATGCCTGTGATGATGACGATGACAATGATAAAATTCCAGATGACAGGGACAACTGTCCATTCCATTACAACCCAGCTCAGTATGACTATGACAGAGATGATGTGGGAGACCGCTGTGACAACTGTCCCTACAACCACAACCCAGATCAGGCAGACACAGACAACAATGGGGAAGGAGACGCCTGTGCTGCAGACATTGATGGAGACGGTATCCTCAATGAACGGGACAACTGCCAGTACGTCTACAATGTGGACCAGAGAGACACTGATATGGATGGGGTTGGAGATCAGTGTGACAATTGCCCCTTGGAACACAATCCGGATCAGCTGGACTCTGACTCAGACCGCATTGGAGATACCTGTGACAACAATCAGGATATTGATGAAGATGGCCACCAGAACAATCTGGACAACTGTCCCTATGTGCCCAATGCCAACCAGGCTGACCATGACAAAGATGGCAAGGGAGATGCCTGTGACCACGATGATGACAACGATGGCATTCCTGATGACAAGGACAACTGCAGACTCGTGCCCAATCCCGACCAGAAGGACTCTGACGGCGATGGTCGAGGTGATGCCTGCAAAGATGATTTTGACCATGACAGTGTGCCAGACATCGATGACATCTGTCCTGAGAATGTTGACATCAGTGAGACCGATTTCCGCCGATTCCAGATGATTCCTCTGGACCCCAAAGGGACATCCCAAAATGACCCTAACTGGGTTGTACGCCATCAGGGTAAAGAACTCGTCCAGACTGTCAACTGTGATCCTGGACTCGCTGTAGGTTATGATGAGTTTAATGCTGTGGACTTCAGTGGCACCTTCTTCATCAACACCGAAAGGGACGATGACTATGCTGGATTTGTCTTTGGCTACCAGTCCAGCAGCCGCTTTTATGTTGTGATGTGGAAGCAAGTCACCCAGTCCTACTGGGACACCAACCCCACGAGGGCTCAGGGATACTCGGGCCTTTCTGTGAAAGTTGTAAACTCCACCACAGGGCCTGGCGAGCACCTGCGGAACGCCCTGTGGCACACAGGAAACACCCCTGGCCAGGTGCGCACCCTGTGGCATGACCCTCGTCACATAGGCTGGAAAGATTTCACCGCCTACAGATGGCGTCTCAGCCACAGGCCAAAGACGGGTTTCATTAGAGTGGTGATGTATGAAGGGAAGAAAATCATGGCTGACTCAGGACCCATCTATGATAAAACCTATGCTGGTGGTAGACTAGGGTTGTTTGTCTTCTCTCAAGAAATGGTGTTCTTCTCTGACCTGAAATACGAATGTAGAGATCCCTAATCATCAAATTGTTGATTGAAAGACTGATCATAAACCAATGCTGGTATTGCACCTTCTGGAACTATGGGCTTGAGAAAACCCCCAGGATCACTTCTCCTTGGCTTCCTTCTTTTCTGTGCTTGCATCAGTGTGGACTCCTAGAACGTGCGACCTGCCTCAAGAAAATGCAGTTTTCAAAAACAGACTCAGCATTCAGCCTCCAATGAATAAGACATCTTCCAAGCATATAAACAATTGCTTTGGTTTCCTTTTGAAAAAGCATCTACTTGCTTCAGTTGGGAAGGTGCCCATTCCACTCTGCCTTTGTCACAGAGCAGGGTGCTATTGTGAGGCCATCTCTGAGCAGTGGACTCAAAAGCATTTTCAGGCATGTCAGAGAAGGGAGGACTCACTAGAATTAGCAAACAAAACCACCCTGACATCCTCCTTCAGGAACACGGGGAGCAGAGGCCAAAGCACTAAGGGGAGGGCGCATACCCGAGACGATTGTATGAAGAAAATATGGAGGAACTGTTACATGTTCGGTACTAAGTCATTTTCAGGGGATTGAAAGACTATTGCTGGATTTCATGATGCTGACTGGCGTTAGCTGATTAACCCATGTAAATAGGCACTTAAATAGAAGCAGGAAAGGGAGACAAAGACTGGCTTCTGGACTTCCTCCCTGATCCCCACCCTTACTCATCACCTGCAGTGGCCAGAATTAGGGAATCAGAATCAAACCAGTGTAAGGCAGTGCTGGCTGCCATTGCCTGGTCACATTGAAATTGGTGGCTTCATTCTAGATGTAGCTTGTGCAGATGTAGCAGGAAAATAGGAAAACCTACCATCTCAGTGAGCACCAGCTGCCTCCCAAAGGAGGGGCAGCCGTGCTTATATTTTTATGGTTACAATGGCACAAAATTATTATCAACCTAACTAAAACATTCCTTTT