Transcript asmbl_19550

Sequence
Transcript Sequence for observation asmbl_19550 of TGE0000515:
CGGCGGGCTACTTAGAGCGCCGAACAGCTCTGGGCCAAAGGACCATGAGAGGGCCGGAGCCGGGTCCCCAACCGACGATGGAGGGAGACGTGCTGGACACACTGGAGGCGCTGGGGTATAAAGGACCATTGTTAGAAGAGCAAGCCCTTACAAAGGCGGCAGAGGGTGGATTATCTTCACCTGAATTTTCAGAGCTCTGTATTTGGTTAGGCTCTCAAATAAAATCATTATGCAACTTGGAAGAAAGTATCACGTCTGCTGGAAGAGATGATCTAGAGAGCTTCCAGCTTGAGATAAGTGGCTTTTTAAAAGAAATGGCATGTCCATATTCTGTACTCATATCAGGAGATATTAAAGATCGTTTAAAAAAGAAGGAGGACTGTTTGAAACTTCTATTATTTTTAAGTACAGAACTTCAAGCTTCACAGATATTACAGAACAAGAAACATAAAAATTCTCAATTAGATAAAAATAGTGAAGTTTATCAGGAAGTTCAAGCTATGTTTGATACACTTGGTATACCCAAGTCAACAACTTCTGACATTCCGCATATGCTAAACCAAGTGGAATCAAAGGTGAAAGATATTCTCTCAAAGGTCCAGAAAAATCATGTGGGAAAACCACTGCTGAAAATGGATTTAAATTCAGAACAGGCGGAACAACTGGAAAGAATCAATGATGCTCTTTCCTGTGAATATGAGTGCCGCCGACGAATGTTAATGAAACGATTAGATGTGACTGTACAGTCCTTTGGATGGTCTGATAGAGCAAAGGTAAAAACAGATGATATAGCAAGAATTTATCAGCCTAAGCGTTATGCTTTGTCACCCAAGACAACGATTACAATGGCACATCTACTTGCTGCTCGTGAAGATCTATCCAAGATCATTAGGACAAGTAGTGGCACCAGCCGGGAGAAGACCGCATGTGCCATTAATAAGGTGCTGATGGGAAGGGTGCCTGACAGGGGAGGCCGGCCGAATGAAATTGAACCACCACCTCCAGAAATGCCCCCTTGGCAAAAGAGACAAGAAGGCGGCGGTGGAAGGGGTGGTTGGGGTGGTGGTGGTGGAGGTGGT