Transcript asmbl_19545

Sequence
Transcript Sequence for observation asmbl_19545 of TGE0000514:
GCCGGAAGTGCATTTGCAGAGTGAGACAAAGCGGAGAACGCTGGTGGGCCTGTTGTGGAGTACGCTTTGGACTGAGAAGCATCGAGGCTATAGGACGCAGCTGTTGCCATGACGGCCCAGGGGGGCCTGGTGGCTAACCGAGGCCGGCGCTTCAAGTGGGCCATTGAGCTAAGCGGGCCTGGAGGAGGCAGCAGGGGTCGAAGTGACCGGGGCAGTGGCCAGGGAGACTCGCTCTACCCAGTCGGTTACTTGGACAAGCAAGTGCCTGATACCAGCGTGCAAGAGACAGACCGGATCCTGGTGGAGAAGCGCTGCTGGGACATCGCCTTGGGTCCCCTCAAACAGATTCCCATGAATCTCTTCATCATGTACATGGCAGGCAATACTATCTCCATCTTCCCTACTATGATGGTGTGTATGATGGCCTGGCGACCCATTCAGGCACTTATGGCCATTTCAGCCAAGAATGGAGTTCAGTGGTGGAGGACTGCTTTTGTGAACATGAGAAAGCAGCGCCTGGTCCCTATGTATTTGGGTCTTATTTACATCCTTCTTTAAGCCCAGTGGCTCCTCAGCATACTCTTAAACTAATCACTTATGTTAAAAAGAACCAAAAGACTCTTTTCTCCATGGTGGGGTGACAGGTCCTAGAAGGACAATGTGCATATTACGACAAACACAAAGAAACTATACCATAACCCAAGGCTGAAAATAATGTAGAAAACTTTATTTTTGTTTCCAGTACAGAGCAAAACAACAACAAAAAAACATAACTATGTAAACAAGAGAATAACTGCTGCTAAATCAAGAACTGTTGCAGCATCTCCTTTCAATAAATTAAATGGTTGAGAACAATGCATAAAAAAAGTT