Transcript asmbl_33744

Sequence
Transcript Sequence for observation asmbl_33744 of TGE0005017:
ATCCGAGAGGGCTCGAGGTCGACGCTACCAGGTTTCGTCGTCGCCGCCGTCGCTGCCGCTGTCGCCGTCGCTGCCGTGTTGAGAGCACCCGTCGCGGCCGTCCCAGCCGCCTTCGCCGGCCACCATGTCCGCCCAGGCACAGATGCGGGCCTTGCTGGATCAGCTAATGGGCACGGCCCGGGACGGAGATGAAACCAGACAGAGGGTGAAGTTTACAGATGACCGTGTCTGCAAGAGTCACCTTCTAGACTGCTGCCCCCATGACATCCTGGCTGGGACGCGCATGGATTTAGGAGAATGTACCAAAATCCACGACTTGGCCCTCCGAGCAGATTATGAGATTGCAAGTAAAGAAAGGGACCTGTTTTTTGAATTGGATGTGGAAGGGGGAGCTCTACCCTCAGAACATGAGGGGTAATATTTGCGTGGCTCACAAAGACCAGCAATGGATCACTTGGAGTCCTTCATTGCTGAATGTGATCGGAGAACTGAGCTTGCCAAGAAGCGGCTGGCAGAGACACAGGAGGAGATCAGCGCAGAAGTTTCTGCAAAGGCAGAAAAAGTACATGAGTTGAATGAAGAAATAGGAAAACTTCTTGCTAAAGCTGAGCAGCTGGGAGCTGAAGGAAATGTGGATGAATCCCAGAAGATTCTTATGGAAGTGGAGAAAGTCCGTGCAAAGAAAAAAGAAGCTGAGGAAGAATACAGAAATTCCATGCCTGCATCCAGTTTTCAACAGCAGAAATTGCGTGTCTGTGAAGTCTGCTCTGCTTACCTTGGCCTCCATGACAATGACCGTCGCCTTGCAGACCACTTTGGGGGCAAATTGCACTTGGGGTTCATTCAGATCCGTGAGAAACTGGATCAGTTGAGGAAAACTGTGGCTGAAAAGCAGGAGAAGAGAAATCAGGATCGCTTGAGGAGGAGAGAAGAGAGGGAGCGGGAGGAGCGGCTGAGCAGGAGGTCTGGCTCAAGAACCAGAGAGCGCAGGAGGTCACGTTCCCGGGACCGGCGTCGGAGGCGGTCAAGATCTACCTCCAGAGAGCGACGAAAGTCTTCCCGGTCCCGGTCCCGTGACAGACACCGGCGCCACCGCAGTCGTTCCCGGAGCCACAGCCGGGGCCACCGCCGGGCTTCCAGGGACCGGAGTGCGAAATACAAGTTCTCCAGAGAGCGGGCGTCGAGGGAGGAGTCCTGGGAGCGCGGGCGGAGCGAGCGGGGGGCCACCGACTGGAGGCTCGAGAGCTCCAACGGGAAGACGGCTTCGCGGAGGTCGGAGGAGAAGGAGGCTGGCGAGATCTGAACCCATGCCCAGGCACTGTAAATAGTCTGATAAACGTTCAACATGCCTGAGGTTACTCTTTATATTTGCTGAATACAACTCATCTTTTGTAGTTTAAAATTTCTATTGTTTCAGAGCTAGCTGTGAGTTTCTAGAGATGTACAGTTGCTCCTGTGTTCTGGGGTTATGTCGAGTAGGAATAAATAAATCTGACAAGACTGCCTCCTGACGACTGCAGTGAGGTCTCTGCTGTTACTGTGTACTCTAGAGACTTGCACCG