Transcript asmbl_33682

Sequence
Transcript Sequence for observation asmbl_33682 of TGE0005013:
CTTAATGGGCTATTTCTGCCAAGGGGCTTTGTAAGACTCTCCCAGCTCTGCATAGTTACACTTGTTTTCATACGTGTAACTTTCGTAATGGGGAGAGAGAGAAAGGATCTCCTCAAGATCTCAGATTGGTCTCATTGTGGCCTCTCCTTCCTTGAGGGGCACAACAAGCCCTGGGCAGTGTTTACTGATAATTGTGTAAGCTAGTGGACCACCAGCCACTTCAGTCTCTTCACAGGCATTTGTTGCCATTGGGGACTACAATGGACATGTCGGTTTGGGTGTCAAGTGCTCCAAGGAGGTAGCCACTGCCATCCGTGGGGCTATCATCCTGGCCAAGCTCTCCATTGTCCCTGTGCGGCGAGGCTACTGGGGGAACAAGATCGGCAAGCCCCACACCGTCCCTTGCAAGGTGACTGGCCGCTGTGGCTCTGTACTGGTGCGCCTCATCCCTGCCCCCAGGGGCACTGGCATTGTCTCAGCCCCTGTGCCCAAGAAGCTGTTGATGATGGCAGGTATTGATGACTGCTACACCTCAGCCAGGGGCTGCACTGCCACCCTGGGTAACTTTGCCAAGGCCACATTTGATGCCATCTCTAAGACCTACAGCTATCTCACCCCTGACCTCTGGAAAGAGACCGTGTTCACCAAGTCTCCCTATCAGGAATTCACTGACCATCTTGTAAAGACCCACACTAGAGTTTCTGTGCAGAGGACCCAGGCTCCAGCAGTGGCTACCACATAATTTTATACAAGAGAAATAAAGTGAATTAAATCTGTT