Transcript asmbl_19544

Sequence
Transcript Sequence for observation asmbl_19544 of TGE0000513:
GCCGGAAGTGCATTTGCAGAGTGAGACAAAGCGGAGAACGCTGGTGGGCCTGTTGTGGAGTACGCTTTGGACTGAGAAGCATCGAGGCTATAGGACGCAGCTGTTGCCATGACGGCCCAGGGGGGCCTGGTGGCTAACCGAGGCCGGCGCTTCAAGTGGGCCATTGAGCTAAGCGGGCCTGGAGGAGGCAGCAGGGGTCGAAGTGACCGGGGCAGTGGCCAGGGAGACTCGCTCTACCCAGTCGGTTACTTGGACAAGCAAGTGCCTGATACCAGCGTGCAAGAGACAGACCGGATCCTGGTGGAGAAGCGCTGCTGGGACATCGCCTTGGGTCCCCTCAAACAGATTCCCATGAATCTCTTCATCATGTACATGGCAGGCAATACTATCTCCATCTTCCCTACTATGATGGTGTGTATGATGGCCTGGCGACCCATTCAGGCACTTATGGCCATTTCAGCCACTTTCAAGATGTTAGAAAGTTCAAGCCAGAAGTTTCTTCAGGGTTTGGTCTATCTCATTGGGAACCTGATGGGTTTGGCATTGGCTGTTTACAAGTGCCAGTCCATGGGACTGTTACCTACACATGCATCGGATTGGTTAGCCTTCATTGAGCCCCCTGAGAGAATGGAGTTCAGTGGTGGAGGACTGCTTTTGTGAACATGAGAAAGCAGCGCCTGGTCCCTATGTATTTGGGTCTTATTTACATCCTTCTTTAAGCCCAGTGGCTCCTCAGCATACTCTTAAACTAATCACTTATGTTAAAAAGAACCAAAAGACTCTTTTCTCCATGGTGGGGTGACAGGTCCTAGAAGGACAATGTGCATATTACGACAAACACAAAGAAACTATACCATAACCCAAGGCTGAAAATAATGTAGAAAACTTTATTTTTGTTTCCAGTACAGAGCAAAACAACAACAAAAAAACATAACTATGTAAACAAGAGAATAACTGCTGCTAAATCAAGAACTGTTGCAGCATCTCCTTTCAATAAATTAAATGGTTGAGAACAATGCATAAAAAAAGTT