Transcript asmbl_19518

Sequence
Transcript Sequence for observation asmbl_19518 of TGE0000512:
GCAGAGTGGAGCGGCCGCCGGAGATGCCTGACGCATCTGTCTGAGGAGCGGTCAGTGACGCGATGGAGCGGGCAAGGGATCGCTTACACCTGAGACGAACTACAGAACAGCACGTACCAGAGGTGGAAGTCCAAGTCAAACGCAGAAGGACTGCCTCACTGAGCAACCAAGAGTGTCAGTTGTACCCGAGGCGTTCTCAGCAGCAGCAAGTACCTGTGGTGGATTTCCAGGCTGAACTGAGGCAGGCATTCTTAGCTGAGACACCAAGAGGTGGTTAAAGCCATATTGGAGTAGCGAGGAATCTGATTCCAAGCAAAAACCAGGCTCCATCTACTCTTTGAAGCTTCTGCCCAGCTTGCATTGTTTCTAGGAGAACCTGCGTCATACCTTTATCTATAGCCTTCCCCTAGGTCTTCAGAAGCATCAAGTTTTAACTGTGGACATTGGATTTGGTGGAACAGCAATCATGACTGTTGGCAAGAGTAGCAAGATGCTGCAGCACATTGACTATAGAATGAGATGTATCCTGCAAGATGGCCGAATCTTCATTGGCACCTTTAAGGCTTTTGACAAGCATATGAATTTGATCCTCTGTGATTGTGATGAGTTCAGAAAGATCAAGCCAAAGAATGCGAAGCAACCAGAGCGTGAAGAAAAGCGGGTTTTGGGTCTGGTGTTGCTGCGTGGGGAGAACTTGGTATCCATGACTGTGGAGGGGCCACCCCCCAAAGATACTGGCATTGCTCGGGTACCACTTGCTGGAGCTGCTGGAGGCCCTGGGGTTGGTAGGGCAGCTGGTAGAGGAGTACCAGCTGGTGTGCCAATTCCCCAGGCCCCTGCTGGATTGGCAGGCCCTGTCCGAGGAGTTGGGGGACCATCCCAGCAGGTAATGACTCCACAGGGAAGAGGCACTGTAGCAGCTGCTGCTGTTGCTGCGACTGCCAGTATTGCTGGAGCCCCAACACAGTACCCACCAGGACGGGGCACTCCGCCCCCACCCGTCGGCAGAGCAACCCCACCTCCAGGCATTATGGCTCCTCCACCTGGTATGAGACCACCCATGGGCCCACCAATTGGGCTTCCCCCTGCTCGAGGGACGCCAATAGGCATGCCGCCTCCGGGAATGAGACCCCCTCCACCAGGCATTAGAGGTCCACCTCCCCCAGGAATGCGTCCACCAAGACCTTAGCATACTGTTGATCCATCTCAGTCACTTTTTCCCCTGCAATGCGTCTTGTGAAATTGTGTAGAGTGTTTGTGAGCTTTTTGTTCCCTCATTCTGCATTAATAATAGCTAATAATAAATGCATAGAGCAATTAAACTGTGA