Transcript asmbl_1895

Sequence
Transcript Sequence for observation asmbl_1895 of TGE0000510:
CCGTCTTAAAGTCCTGCGCGATCTCGCGTACCAGCCGCTGGAAGGGCAGCTTGCGGATCAGCAGCTCCGTGGACTTCTGGTAGCGCCGGATCTCCCGCAGGGCTACGGTGCCGGGCCGGTAGCGGTGCGGCTTCTTCACCCCGCCCGTGGCCGGCGCGCTCTTGCGGGCCGCCTTGGTGGCCAGCTGCTTCCTCGGGGCCTTGCCGCCGGTCGACTTGCGAGCAGTCTGCTTAGTACGGGCCATAGCGAACCAAAACAC