Transcript asmbl_18305

Sequence
Transcript Sequence for observation asmbl_18305 of TGE0000509:
CTAATGTTTGCCCATCGTCCACGATCTTGGAGGGAAATGCCTATTAGATTTGCTGATTTTGGAGTTCTGCATAGAAATGAACTGTCGGGGACTCTCAGCGGCTTGACCAGAGTGAGGCGCTTCCAGCAGGACGATGCTCACATTTTTTGCACAGTGGAGCAGATTGAAGAAGAAATAAAGGGGTGTTTGCAGTTTTTGCAATCTGTTTACTCAACATTTGGCTTCTCCTTTCAATTAAACCTGTCAACAAGGCCGGAAAACTTCCTAGGAGAGATTGAGATGTGGAATGAGGCTGAGAAGCAACTGCAGAACAGCTTGATGGACTTTGGAGAACCGTGGAAAATGAACCCAGGAGATGGAGCATTTTATGGCCCTAAAATTGACATAAAAATCAAGGATGCTATTGGCAGATACCATCAATGTGCTACAATTCAGCTGGACTTCCAACTGCCTATTAGATTTAATCTCACATATGTTAGTAAGGATGGGGATGATAAGAAGAGACCTGTGATCATTCATCGAGCCATTTTGGGATCAGTGGAAAGAATGATAGCCATTCTTTCAGAAAACTATGGCGGAAAATGGCCTTTCTGGCTATCTCCTCGTCAGGTGATGGTCATCCCTGTGGGGCCAACTTGTGAAAAATATGCACTTCAGGTATCCAGTGAATTTTTTGAAGAAGGATTTATGGCTGACGTTGACTTGGATCACAGTTGTACACTAAATAAGAAAATACGAAATGCACAGCTGGCTCAGTATAATTTTATTTTGGTGGTTGGAGAAAAGGAAAAGATAGATAATGCTGTAAACGTGCGAACAAGAGACAACAAAATTCATGGAGAGATTTTAGTAACTTCTGCCATTGATAAACTGAAGAATCTCAGGAAGACACGGACACTCAATGCTGAGGAGGCCTTTTGAAGTCCTTCCCTGATATTTGCTTCTGTGTAACTTTGTTTTGACCCTTAAAAATGTATTTTTCTTAACATGTTAGTACTTCTACGACTTTGGAGCCACTGATGGGTCCACTCATGGCCTCAGCTGAGAAAGGAGACGATGAACGTGTAGCTGACATGC