Transcript asmbl_42066

Sequence
Transcript Sequence for observation asmbl_42066 of TGE0002528:
CAGGACGCGTTCCCGGCGGGCCCCGCGCGGCCAGGGCGTGGGCGGTGCTCCCCCTCCCCCCCGGCGGAGCTGCCCGCGCCCCCTCCCCTCGGATGTGGCTGAACCGAAGCGCGCAGGCGGGAGACTCTGCAGGATCCGCGGCCCTGAGCATCGGAGCGGTGAACTCTTCAAGTCTCCGATTAAATTTAAAAAATGGCCTCCAATAAAACTACATTGCAAAAAATGGGAAAGAAACAAAATGGAAAGAGTAAAAAAGTTGAAGAGGCAGAGCCTGAAGAATTTGTGGTAGAAAAAGTACTGGACCGTCGTGTAGTGAATGGGAAGGTGGAGTATTTCCTGAAGTGGAAGGGGTTCACAGATGCTGATAATACTTGGGAACCAGAAGAAAATTTAGATTGTCCAGAATTAATTGAAGCATTTCTTAATTCTCAAAAAGCTGGTAAAGAAAAAGATGGTACAAAAAGGAAATCTTTATCTGACAGTGAATCTGATGATAGCAAATCGAAGAAGAAGAGAGATGCTGCTGACAAACCAAGGGGCTTTGCCAGAGGTCTCGACCCTGAACGAATAATCGGCGCCACAGACAGCAGCGGAGAGTTAATGTTTCTCATGAAGTGGAAGGACTCGGACGAGGCCGACTTGGTGCTGGCAAAGGAGGCGAACATGAAGTGTCCTCAGATTGTCATTGCCTTCTACGAGGAGCGGCTGACTTGGCATTCTTGTCCTGAAGATGAAGCACAATAATTGTTTGCATTTATATATATATATTTATATATATATATAAAATCTGGATCTTGGGTTTTGAATTACTAGTGTGGAAAAAAATAGCATTCTAATGAAAATCAAGTTTGATATGCTGGTTTTGAAAGTATTGACAGTAGTTGGGATATTTTTGGTTTTTGTTCTGCATCAAAAGGCACTGATTCCTTTGAGCAAGTAAGAGCTTTCTGTAGTTGCTTCCTTTAACAATAGAATATTTGATACCATGTTGTATTTCCTCAGCTTTGAAGAACAGCTTTTCTTAAACGCTGGGGAGATTTTACAGTTATTACTCAAGTCAGAACTTATTTTTAACTGGGACACAGAAGGACCATTCTGGGTTTTTTTTTGTTTTTTTTTT