Transcript asmbl_41541

Sequence
Transcript Sequence for observation asmbl_41541 of TGE0001880:
CGGCGGTGGCGGAAGTGGAAGCAAGGCCGGAGCTTTGACCATAAAGCCCAAGGCGGCGGCGTTGGCGGCGGTGTTTGGGGCCGGGCAGCTCCGAGGAGCCTGCTGGAGCCGGAATCGGACGTCTCTGTTGCGGCCTGCGTTGTGTCTCCTCCTCCGTTGACCCTGCGCTTCAAGGATGACCTCTAGGAAGAAAGTGTTGCTGAAGGTCATCATCCTGGGGGACTCTGGTGTTGGAAAGACCTCTCTCATGAACCAGTATGTGAACAAGAAGTTCAGTAACCAGTACAAAGCCACAATAGGAGCGGACTTTCTGACCAAGGAGGTGATGGTGGACGACAGACTTGTTACCATGCAGATCTGGGACACAGCCGGTCAAGAACGGTTCCAGTCTCTTGGTGTGGCCTTCTACAGAGGTGCAGATTGCTGTGTTCTGGTGTTTGATGTGACTGCCCCCAACACTTTCAAAACCCTCGACAGCTGGAGAGACGAGTTTCTCATCCAGGCCAGCCCCCGGGATCCCGAGAACTTCCCTTTTGTTGTGTTGGGAAACAAGATTGACCTGGAAAACAGACAAGTGGCCACAAAGAGGGCACAGGCTTGGTGCTACAGCAAAAACAACATTCCTTACTTCGAGACCAGTGCCAAGGAGGCCATCAATGTGGAGCAGGCCTTCCAGACAATTGCTCGGAATGCCCTTAAACAGGAAACAGAAGTGGAACTGTACAATGAATTCCCTGAACCCATCAAACTGGACAAGAATGACCGGGCCAAGGCCTCCGCAGAAAGCTGCAGTTGTTGAAGGGGCAGTGAGCACAGAGTCCTTCACAGACCAAGAACACACACGTAGGCCTTCAATATGCGTCCCTCCTCCTCCAAACAGACCAGAACGTGAGCTCTCACATCCAGCTGCCAAAAGAAACTCCACCGAACAGTTACCCAACACACACACATACACAAAACACACTCGTGCACACAAAAACACATACACACAACACACACACAGCAAGCAAACTCCAGCCTGTGCCTGTCAGGGCTCCTGGGGCAGCTGCCCGCCTCGTGGGCCCTGTGTATGGCAGGCATATGGCAGAGACCCTGGGTGCTCTGGGGTGCAGTGGGCATGGAAAGCTTACTCTTTTTGTCCACTGGAGAGTGAGAGAACTGTTCACAGTTCATCTGTGTCTAATTATCTGATTTTTTTTTTAACGGTCTTGTGGTCTTTTACCCCTCCCTCCTTGAAGGTCCTGTGGGAAGGCTGGTGCCCAGGCTCCGTTCTGAGCAGGCTGTTTTGTATGTATCTGTTAATGCTTGTTACTTTTAACTAATCAGATCTTTTTACAGTATCCATTTATTATGTAATGCTTCTTAGAAAAGAATCTTATAGTACATGTTAATATATGCAACCAATTAAAATGTATAAATTAGTGTAAGGAATTCCTGGATTGTGTGTTTAAGTCCTCTAACGCAGGCGTGCAAGGTGGAGGGTTGAACCCTGTCTGGATTACAGAGTGTTAGAGACTCAAGTTTGGAAGTCCAGCTAGCGGCAGTATTCTGTACAGTAGACACAAGAATTATGTACGCCTTTTATCACAGACTTAAGAGCCAAAAAGCTTTTCATCTCTCTGAAGGGAAAACTGAACTAGACAGTTCCCTTCTGTGTCTAAATTTTCCAAAAGGTTGATTTGCTTAATATAGTAGTGTATACAATGGATAAATTGCTGTTACTTCAAGAATTAAAATTCTCATTTTCTCCCTTTCTGTTTTTTTTCCTTATATTCAACACTTTATGATGCCCTTTTGTCACTATCCTACTCAAAGAGGAAAGGAGAACCCACCAGACCTGTCCCAGTGACTCTACCTTTGTTCTAGAAGGCGCTCCTTTCAGGGTTGTGGTACCTGTAGGTTAGCAGACCCTCCTCCTTTCCCACCCACCCAAGTGTGGCCCAGCACTAACCCACCGTCTCTTGGGTTGAGCCCTGGCAGTTCTGTCCCTTCCCGAGGTCCTGCCCTGCATCATGGCTTGCTTCCTGGAGCACTTCCCCTTCAGAGGTCTACATTCTAGGGTGTAGGCTGAGTTCTTCTGTAAAGAGACGAACGTGATGCCAATAAAATTTAACAAGAACAAAGAA