Transcript asmbl_18275

Sequence
Transcript Sequence for observation asmbl_18275 of TGE0000505:
CCGGCTCTGTGCCGGGGTGCCCGGGCGGTCGGGAGAATGAGCCGCATCTACCACGACGGCGCGCTCCGGAACAAGGCGGTGCAGAGCGTCCGGCTGCCAGGGGCCTGGGACCCCGCCGCCCACCAGGGGGGAAATGGTGTCCTGCTGGAGGGAGAACTGATCGATGTATCTCGGCACAGCATCTTGGACACTCATGGCAGGAAGGAGCGCTACTACGTGCTGTATATCCGGCCCAGTCACATCCATCGCCGTAAATTCGACGCCAAGGGAAATGAAATCGAGCCCAACTTCAGCGCCACCAGGAAGGTGAACACGGGCTTCCTCATGTCGTCCTACAAGGTGGAAGCCAAGGGGGACACTGACAGGCTCACGCCCGAGGCGCTGAAGGGGCTGGTCAACAAGCCAGAGCTGCTCGCGCTGACAGAGAGCCTCACCCCCGACCACACAGTGGCGTTCTGGATGCCCGAGTCAGAGATGGAGGTGATGGAACTCGAGCTGGGGGCCGGGGTACGGCTGAAGACTCGGGGCGATGGTCCCTTCCTGGATTCATTGGCCAAACTTGAGGCTGGAACAGTGACCAAGTGTAATTTCACTGGTGATGGAAAGACAGGGGCATCCTGGACAGACAACATCATGGCCCAAAAGTGTTCGAAGGGGGCTGCAGCGGAGATCCGAGAGCAGGGGGATGGGGCAGAGGACGAGGAGTGGGATGACTGAGGGACGTGGCTGCCTCTGGGGGCACCAGCACCTTCTGTAGCATTGTGGAACATTTCTTCCATGAACTTCTACTCTGGAGCTGGAGAGAACAGTCTGCCAAGTCTTACCTGGTTCTTCCCCATAGCCACCTTGGAATACTCTTTGAACAAGCTCTGCTAAAACCAAACCCATGACCACTGTGTTGGTGGTGGGGCCTCATGCTGTGGCTCAGGGAGGGCCCCTCCCTGCATGTGAGTCTAGCCTTCCTAGACATTACATGATGACCCTTTAAAAAAAAATTAGAGATGGAGGTCTCACTATGTTGCCCAGGCTGATCTCAA