Transcript asmbl_32560

Sequence
Transcript Sequence for observation asmbl_32560 of TGE0004922:
GGAGGTGGAGGAGGAGGAGGATGGGAAGAAAGGTTCCTTGGAGACCCTGGAGGAGCTGGTCCAAGGACTAGCCTCTGAGGTGTGTGATGATTTTCTTTTCTACTGTGGAGACACACATAGCAGCTTCGTGGTCAGAACTCTGCTGCAGGTGTTAGGAGGGACTCTTCTGGAGTCTGAGAGAGCCAGACACCGTGGCTCCCAGTCACCTGAAACACAAAGGGCCCCACCTCGAGAATGTAAACCAACTGATTTTGAGGTTCCTGAATCCTTCTTGAATTGCCTTCAGGACCTGAGCTCCTGCTTTCTGAAGGATATTGCTGTGTTTATCACTGACAAGATCTCCAGCTTCTGCCTTCAAGTGGCCTTACAGATCTTACACCGCAAACTTCCCCAGTTTTGTGCCCACCTCTGTAATGCTGTGATTTGCTACCTGAGTAACCGCAATTCCTCAGCAGATGGCAGCCCCCTACTGCTATTTCTGCGGGATCAGACGAGCTCCAGACTCCTGGAGCAGGTGCTGCTGGTGTTGGAGCCTCCGAAGCTCTGGAGCCTCTTTGAGGATCACTTCCAAGGGCAGCTGCAGATCCTCGCTGCACATCCTATTGCCAACTTCCCTTTGCAGCGTTTACTGGATGCTATCACTACACCTGAGCTACTGTCCTCCGTGTTTGAGGAGCTGAGCCCTGCCTTGGAAGCTGTGCTGGCCCAGGGTCACCCAGGGGTAGTTGTTGCCCTGGTGGGGGCCTGCCGCAGAGTTGGAACCCACCAAGTCCAGGTCCTGCAGCTGTTGTTAGAGGCATTCCACTGTGCAGAGCCCTCTTCCCGGCAAGTGGCCTGCGTGCCTCTCTTTGCCACTTTGATGGCTTACGAGGTGTACTATGGACTAGTAGAGGAGGAGGGGACAGTGCCTGCAGAGCACCAGGTTGAAATGGCCACAGCCAGGGCCCTAGGGGAAGTGTCAGTCCTTGGGTCTCTACTGCTCCAGCATCTATTACATTTCTCTGCTCCTGGCCTTATACTTCGAAGTCTGGGTGCCTTGACAGGACCACAACTTCTGACTCTGGCCCAAAGCCCTTCTGGTTCCCATGTGCTTGATGCCATCCTGACCAGTCCCTCCGTGACGCACAAGCAGCGCCGCCGTGTGCTGAAGACCCTAAAGGGACAATATGTGGCTCTGGCTTGCAGTCGCCATGGCAGCCGTGTGCTAGATGTCATCTGGGGTGGAGCAGCCTTGGGGGCCCGGAAGGAAATTGCTGCTGAGCTGGGGGAGCGGAACCAGGAGCTGATAAAAGATCCTTTTGGCCACCACGTGGCTCGAAATGTGGCCCTGACTACCTTCTTGAAGCGACGAGAAGCTTGGGAACAGCAGCAGGGGGCGGTGGCCAAGCGGAGGCGGATTTTGAACTCAATACTTGAGGACTGAGGCCTTGGGATCCGGGACTGGGTGTTGATGGGGGAGGGGGAAAGGGAGTATCTATTTTATCCCCTTCCTGGTTTAAATTGGAGTCAAAA