Transcript asmbl_37684

Sequence
Transcript Sequence for observation asmbl_37684 of TGE0017903:
TGTAAATGTAAGACAAAGTTTAATTTTCTTCTTAACATTTTAATACTGCTTTTTGTCTTTACAGGAAAATGTTTATAGGAGGCCTTAGCTGGGACACCACAAAGAAAGATCTGAAGGACTACTTTTCCAAATTTGGTGAAGTTGTAGACTGCACTCTGAAGTTAGATCCTATCACAGGGCGATCAAGGGGTTTTGGCTTTGTGCTATTTAAAGAGTCGGAGAGTGTAGATAAGGTCATGGATCAGAAAGAACATAAATTGAATGGGAAAGTCATTGATCCTAAAAGGGCCAAAGCCATGAAAACAAAAGAGCCTGTCAAAAAAATTTTTGTTGGTGGCCTTTCTCCAGACACACCTGAAGAAAAAATAAGAGAGTACTTTGGTGGTTTTGGTGAGGTTGAATCCATAGAGCTCCCTATGGACAACAAGACCAATAAGAGGCGTGGGTTCTGTTTTATTACCTTTAAGGAAGAGGAGCCAGTGAAGAAGATAATGGAAAAGAAATACCACAATGTTGGTCTTAGTAAATGTGAAATAAAAGTAGCCATGTCAAAGGAACAGTATCAGCAGCAGCAGCAGTGGGGATCTAGAGGAGGGTTTGCAGGCAGAGCTCGCGGAAGAGGTGGAGGCCCCAGTCAAAACTGGAACCAGGGATATAGTAACTATTGGAATCAAGGCTATGGCAACTATGGATATAACAGCCAAGGTTACGGAGGTTATGGAGGATATGACTACACTGGTTACAACAACTACTATGGATATGGTGATTATAGCAATCAGCAGAGTGGTTATGGGAAAGTATCCAGGCGAGGTGGACATCAAAATAGCTACAAACCATACTAAATTATTCCATTTGCAACTTATCCCCAACAGGTGGTGAAGCAGTATTTTCCAATTTGAAGATTCATTTGAAGGTGGCTCCTGCCACCTGCTAATAGCAGTTCAAACTAAATTTTTTCTATCAAGTTCCTGAATGGAAGTATGACGTTGGGTCCCTCTGAAGTTTAATTCTGAGTTCTCATTAAAAGAATTTGCTTTCATTGTTTTATTTCTTAATTGCTATGCTTCAGTATCAATTTGTGTTTTATGCCCCCCCTCCCCCCCAGTATTGTAGAGCAAGTCTTGTGTTAAAAAAAGCCCAGTGTGACAGTGTCATGATGTAGTAGTGTCTTACTGGTTTTTTAATAAATCCTTTTGTATAAAAATGTATTGGCTCTTTTA