Transcript asmbl_32145

Sequence
Transcript Sequence for observation asmbl_32145 of TGE0004896:
CCCAAGCATCGCCCCCACTTCCGGCCACTTCCGGCCACCTCAGGCCTTTTCCGCTTGTTCTCTGCTGGTTTTAATCTCTCCTTCTCAGGTTGTTTCCGACTGTAGGCCCGGGTCATCTAGCACCCCTTTCCTGCTACCAGCAGTTCGCTGCTCATCCGGTTTCTGTCCGAGGTTTGGAGCAACTCTGCCGTGCAAATTCGCGGAGCGGTCGGGGCTGAGGCCTTCCGCGCACAGTGAGTCCGCGCAGACCTGACCCCGCGTCTACCTACAGCTCCGTGGAGGCCACCGCCGCCTCCGCCTAGGGATGCCGCGGCTGGGGTCCGCGCAGCGCTGGGCGGCCGCTGTGGGCCGTTGGGGCTGCAGGCTGCTCGCGCTGCTGCTGCTGGTGCCGGGACCCAGCAGCGCCTCTGAGATCACTTTCGAGCTGCCTGACAATGCCAAGCAGTGTTTCTACGAGGACATCACGCAAGGCACCAAGTGCACCCTCGAGTTCCAGGTGATTACTGGAGGTCACTATGATGTAGATTGTCGATTAGAAGATCCTGATGGTAATGTGTTATACAAAGAGATGAAGAAACAATATGATAGTTTTACCTTCACAGCTTCTAGAAATGGGACATACAAATTTTGCTTCAGCAATGAATTTTCCACTTTCACACATAAAACCGTATACTTTGATTTTCAAGTTGGAGAAGACCCACCTTTGTTTCCTAGTGAGAACCGAGTCAGTGCTCTTACCCAGATGGAATCTGCCTGTGTTTCAATTCACGAAGCTCTGAAGTCTGTCATCGACTATCAGACTCATTTCCGTTTGAGAGAAGCTCAAGGCCGAAGCCGCGCAGAGGATCTAAACACAAGAGTGGCCTATTGGTCAGTAGGAGAAGCCCTCATCCTTCTGGTGGTTAGCATAGGGCAGGTATTTCTTCTGAAAAGCTTTTTCTCAGATAAAAGAACCACCACAACTCGTGTTGGATCATAACTACGTTTTGAGAATTGATGCACCATTGCAACTATAATATTGCTGTCTTCTAATTAATTAATTTTAGGTACTGAAGAACTTGATATTGGCAACATTTTCAAAACCTTATTCATATACTTGTTAGGGGGTTATGTACAATGCATAAACCCAAACAGTGGAAAGGACACCTTTTTTTATTTGTAAAGGTATAAAAACTTTGGAACTTATTTTGGGCTATTCATGTTAAATATTCAACACCAATGATCTGCTCTTTGTTGTTTATATCTACTCTTTGCACACTAAACTTTGGTATTTTGATTTAGCCATTTAAAAGTACTTTTCTTATAGGTAGTGGATACTTTAAAAACCTTTGATTTAATGTCTACATGTGTTGTGGAGGAAGAAAATTGCCTTTTGATTGTTTATAGTAAATAAGGATTTGTTTTTCAGAAATGCATATGTGATTAACTGCAGTCCACGCCCTATTCTGCACTGTTTAATTTTTATGGGGGAAGAATCTACAATAGAAATGTTTGTTGATATTGATATAATTTTAAATCGATACATCATGGTATAATTTATTTATCACTAGCTTGGAAAATGTCAGATTTTGGCAGGGAGGCAGTTTATTCTATGATTTATAACCAGATATGTTCTTTTTTTCTTAAAGACATTCTTCCACACAAAATAGTGTGTTTCAGTAACATCATAGGGTTTATATGGGCCTTAAAAATCAGATTGTCATGATAAAATAATTAAGAATAATTAAAGTCACTACAATGTCTTATAGTGGAGGGGCAAATGAGAAAATTTTTAGTGAGTTATCTGCACACACTACATTTTCAGTGCTTTTACAAAGAAAAAAGGTGATCTGTTTCATTTTAACATTTTATTGGCTGGTTCTTGCCCTTATGTGGCTTTAATGTCTGAGTCATTCCCAACTTAAAATGACAGTTGTAATATTAGTATCGTAAAAGTGCCATACATTTTATCCTGATTGGTGTGATACACTGAAAAATTAGTTTTTCCCTCCTTCCTTCCCTCCTTCCTTCCTTCTTTCTTTCTGTCTTTCTTTCTGTCTCTCTGTCTCTTTGTCTTGTACATGTAATTTGTACAGTCTCTGCTTAGCAGTCCTATAATTTAAAAATTTAGAATGCTATATGTGTTTTTTATTTGATAATCTTCATTGACTGTACTGCATTTAATGAATATTAAATAGTGCATATTCTGTACACTATAGGGTTTAGACTGTGTTTGTATTTTATAATTTGCGTAGATTAAGCTGATTGAAATAAGATTTTATTCCAGGTATTCTAGAGTAGAATACGAGGTGATGCAAATTGTATAGGTGGTTAAAGCTTTTCTGCCCTTTTAAAAAAAAATTTGCAACTGCTTTTTGCCGTGCCTATCTCCTTCACCCAGAAGTGATAAGTGCTGAACAAGACTCATTGTAGAGACTTTCTTATGTGGTACCATAAAATACTGATGGGATACTAATTCTAGTCACTTAGCACTACTGACTAGAAATAGAAGTTAACTCAACTCTAAGCTGTGTTAAAATGCATATATTTTCTACTGCATGAAAGCGAAAGGAATTCAAGTTGTCATGCTGGCTAGTTTCAAATGCTACAGTGTAGCAAGGGATAAACATGTTTTTAACCCTTAAATTCTAAAATTTTTGAAGACCAAATAGCTAATCCTTAAACTATATCAAGAATTAAGAACTGAAGTTTAAGATTGCAGATTTATCTATGTGGATTCTTATTTTGGAGTTGTCCTGCAGCTTTATAAGTGTCCCTCTATTTTAGATTTGAAATTTTTCAACACTAATGTTGATGTGATTCATAAGCGTGGGTGTGTATTAAATGTCCTTTTTGGTTACCTGTCTGCTCTATTGTATTCAGATTCTTAGACCATAATTAAGCAGAGTCAGGTATCAGTGTGCCGAGTTTGGCATAGATAATGCAGTTATTTCATCTTTGCCTATCAAAACTTCATAATATTAGACTATTACTACAAATAACTTTTGATGAAACTATTGATACTAAAATGTTCGAAATATCTGCTGTTCCTATTGTAGAAAATAGTACAGGCTTAGTCTAGTTTGTATGTAATTGGTTAATGTTTGATGGATGGCTGTCTATACTCAACTGGGTATGTATATATAATTTAGAAAATACGTATCTGTCCAGACATAAGTGTTAAGTAAACTTTTTTCTTCCTCTTCTATATAATTTGTAGCTCATTTTTTTTCTTTAATCCTTTCATAACTTGCTACAGCAGTTTGAATTTCCTGAATGTTTATGTTTCAACAGATGGCTCAGAATACATATTTAAACACCATTAGATGTATATATTTTTAAAGTAGAATAAATAATGGAAAGGGACTTGATATACAAGTTTATACTAAAATTTCAACTGTGTGAAGATACATTAGAAGATATTACTTTGCTAATACTCTAAACATTCTTTTTTCTATTAAAAGAAACGGTTTATGGTTCATAACTTTAATTCTGGCTTCATGATAATCAGCTTTGAAAATACAATGGACCGAAGAGCAATTTTATTCTTTGGAAGATTTCATTTAAATCTCTGTACTATCCATTTTTTCTTCAGTTTGTAAATGTGTAATATTGATCATTAACTAGGACAAAGCAGACCCTATGACTATTGTTTTCAAGAATTAAATTAATATATAAATAATTCAAAGAGGTCTTTCATTTACTTTTGAAGAGAAAACTTGCTCTGAACTGATATTGGTTCTGTAGGTTTGCACCAATCCTTGTAGAATAAAAATATCTTTCAACAAACTGACTTGTTTCTATTAGGATTTAAGCCCTTTTAAAGATCCGTATCAGCTTGCAGCTTGGAAGTACAGTTCTGTAGCGAGAGTGCTTATTTATTTGCTATTTCATTGAAGCATCTTAGGAGCTGGCCAAGAAAGATAAAGAGAAATACAGGTATTCCCCACTTTTCGAAAGTTCACATTATGCCACTTCGCTTTTGCAAAACATCTACATTAGATGTACCTGTCTTCACTAACTGAAGGAAGTCTGAAAAGGACGTCTTAATGAGAAAACGTGAAAAGTGAAAATAGCATTCAGCATTTGTTTTGCAGTGAGCCATTACAGTCAGCAACCACCTAGAGCAGCAAGAGTGGCATTGCTTTTACTATATATTAGTGCTATTTTAGGTTTTATGTGTTATTTGGTAGCTTATTTGGG