Transcript asmbl_32058

Sequence
Transcript Sequence for observation asmbl_32058 of TGE0004893:
GGCTTGCTCGCGGTGGCTTGTGGCTCCTTCCTGTGCTCCTTCCCTCTTTTGCTTAGGCCGGTGGTGTTGGCAGGATGGGCAAGTGTCGCGGTCTTCGTACTGCAAGGAAGCTCCGAAGCCATCGGCGAGATCAGAAGTGGCATGATAAACAGTACAAGAAAGCCCATTTGGGCACAGCCCTGAAAGCCAACCCTTTTGGAGGCGCATCCCATGCCAAGGGAATTGTGCTGGAAAAAGTAGGGGTTGAAGCCAAACAACCAAATTCTGCCATCAGGAAGTGTGTCAGAGTCCAGCTCATCAAGAATGGCAAAAAGATCACAGCCTTTGTACCCAATGATGGTTGTTTGAATTTTATTGAGGAAAATGATGAAGTTCTGGTTGCTGGATTTGGTCGCAAAGGTCATGCTGTTGGTGACATTCCTGGAGTCCGCTTTAAGGTTGTCAAAGTAGCCAATGTGTCTCTCTTGGCTTTATACAAAGGCAAGAAGGAAAGACCAAGATCATAAGTTTCAATGGTGAAAACACAGTAATAATAAATTTTCATATGCCAAAAATAGGTTGTGTCTTATTTTCTTTACCACAGAGATATATGCTTTACCAATTTTAGGAGATTTGGAAAATATTTGATTCAGAGTTCTCTAGAGTAAATGCGATTCACAGTAAAGTTTATCCCCTGCATGTAATAAAATAACAGTAAATCTAGAAGAAATAAATGTACAGCATTCTTGTAAAGAGGACTTAACACTGAATTTCTAGCAGTATCATCTTAGGAATTCTTGATAATGCACATTCTTAGATTCATCTTCCTGGGGACTCAGTATAATAAATACTATCAAG