Transcript asmbl_18233

Sequence
Transcript Sequence for observation asmbl_18233 of TGE0000498:
GCAGTCGCGCGGAGCCCGGCTTCCGACGTGCAGCCTGGCAGTGCAGTGAGCTGTCTGGCCTTTTGTCCTTGATCCTTGGTTAAGGAAATGACCAACCAGTACGGTATTCTCTTCAAACAAGAGCAAGCCCATGATGATGCCATTTGGTCAGTTGCTTGGGGGACAAACAAGAAGGAAAACTCTGAGACAGTGGTCACAGGCTCCCTAGATGACCTGGTGAAGGTCTGGAAATGGCGTGATGAGAGGCTGGACCTACAGTGGAGTCTGGAGGGACATCAGCTGGGAGTGGTGTCTGTGGACATCAGCCACACCCTGCCCATTGCTGCATCCAGCTCTCTTGATGCTCATATTCGTCTTTGGGACTTGGAAAATGGCAAACAGATAAAGTCCATAGATGCAGGACCTGTGGATGCCTGGACTTTGGCCTTTTCTCCTGATTCCCAGTATCTGGCCACAGGAACTCATGTCGGGAAAGTGAACATTTTTGGTGTGGAAAGTGGGAAAAAGGAATATTCTTTGGACACGAGAGGAAAATTCATTCTTAGTATTGCATATAGTCCTGATGGGAAATACCTAGCCAGTGGAGCCATAGATGGAATCATCAATATTTTTGATATTGCAACTGGAAAACTTCTGCATACCCTGGAAGGCCATGCCATGCCCATTCGCTCCTTGACCTTTTCCCCGGACTCCCAGCTCCTTGTCACTGCTTCAGATGATGGCTACATCAAGATCTATGATGTACAACATGCCAATTTGGCTGGCACGCTGAGCGGCCATGCCTCCTGGGTGCTGAACGTTGCATTCTGTCCTGATGACACTCACTTTGTTTCCAGTTCGTCTGACAAAAGTGTAAAAGTTTGGGATGTTGGAACGAGGACTTGTGTTCACACCTTCTTTGATCACCAGGATCAGGTCTGGGGAGTAAAATACAATGGAAATGGTTCAAAAATTGTGTCTGTTGGAGATGACCAGGAAATTCACATCTATGATTGTCCAATTTAAACATCAAAGTCTCCAGGCTTATGCTGCAAAGAGAATGTACGGATTGATCATGACATTCCTTACCTTCTTAGGCTTGTTTAAAAGAAATATAGCATTTATTGTAGCAAAGACTTAAATTTTGTAGATACAATATGAATCTTTTCATGTTTTATTGGAAATGCTGTTCATACTTTAACATAAAGCTTTCTTAATGCAA