Transcript asmbl_31724

Sequence
Transcript Sequence for observation asmbl_31724 of TGE0001954:
CAGCCAATAAAAGGGAAGCACGGGAGGGCGGGCTAAAAAGGTCGCGTGCGCACGCGCAGACGGCTGCAGGGTCCTTGGTGCTGTGGCGGTGTGGTTGATTAGGGTGCTGCTTTCAATCGTGTGGCCTTTGGGAACCCCGCGTAGCCACTGCCGCCTCCTTCTGTCCTCGCCATGTTCCTCACTCGGTCCGAGTACGACAGGGGTGTGAATACTTTTTCTCCTGAAGGAAGATTATTTCAAGTGGAATATGCCATTGAGGCTATCAAGCTTGGTTCTACAGCCATTGGCATCCAGACCTCAGAGGGTGTATGTCTAGCTGTGGAGAAGAGAATTACCTCCCCACTAATGGAGCCTAGCAGCATTGAGAAGATTGTAGAGATCGATGCTCATATAGGTTGTGCCATGAGTGGGCTAATTGCTGATGCTAAAACTTTAATTGATAAAGCCAGAGTGGAGACACAGAACCACTGGTTCACCTATAATGAGACAATGACAGTTGAGAGTGTGACCCAGGCTGTGTCCAATCTGGCTCTGCAGTTTGGAGAAGAAGATGCAGATCCAGGTGCTATGTCTCGTCCCTTTGGAGTAGCATTGTTGTTTGGAGGAGTTGATGAGAAAGGACCCCAACTGTTTCACATGGACCCATCTGGGACCTTTGTACAGTGTGATGCTCGAGCAATTGGCTCTGCTTCTGAGGGTGCCCAGAGCTCCTTGCAAGAAGTTTACCATAAGTCTATGACTCTGAAGGAGGCCATCAAGTCCTCGCTCATCATCCTCAAGCAAGTCATGGAGGAGAAGCTGAATGCAACCAACATCGAGCTAGCCACGGTGCAGCCTGGTCAGAATTTCCACATGTTCACAAAGGAAGAACTGGAGGAGGTGATCAAGGACATTTAAGAAGGAGCCGTCCTCGAACTTCTGTGGGACACTTTCAGTTCTAATTGCCCTTAGACTTTATTTCCAGCTCTTATGTCATGGAAAATATCCAGTATATGTGTGTGTGTTTTTTTATGAAGTCTGTACATAACAGCAATTCTG