Transcript asmbl_18217

Sequence
Transcript Sequence for observation asmbl_18217 of TGE0000497:
GTCTCGCGAGCATTAGGTGACTGGCTGAGGCGGCGCCAGTTGGCCGGGCACGGGGCTGCTGTAAGGCCGAGGTTGCGGCGGAAGCGGAGACCATGTTCCGAGCGGCGGCTCCGGGGCAGCTCCGGCGGGCGGCCTCATTGCTACGATTTCAGAGTACCCTGGTAATAGCTGAGCATGCAAATGATTCCCTAGCACCCATTACTTTAAATACCATTACTGCAGCCACACGCCTTGGAGGTGAAGTGTCCTGCTTAGTAGCTGGAACCAAATGTGACAAGGTGGCACAAGATCTCTGTAAAGTAGCAGGCATAGCAAAAGTTCTGGTGGCTCAGCATGATGTGTACAAAGGCCTACTTCCAGAGGAACTGACACCATTGATTTTGGCAACTCAGAAGCAGTTCAATTACACACACATCTGTGCTGGAGCATCTGCCTTCGGAAAGAACCTTTTGCCCAGAGTAGCAGCCAAACTTGAGGTTGCCCCGATTTCTGACATCATTGCAATCAAGTCACCTGACACATTTGTGAGAACTATTTATGCAGGAAATGCTCTATGTACAGTGAAGTGTGATGAGAAAGTGAAAGTGTTTTCTGTCCGTGGAACATCCTTTGATGCTGCAGCAACAAGTGGCGGTAGTGCCAGTTCAGAAAAGGCATCAAGTACTTCACCAGTGGAAATATCAGAGTGGCTTGACCAGAAATTAACAAAAAGTGATCGACCAGAGCTAACAGGTGCCAAAGTGGTGGTATCTGGTGGTCGAGGCTTGAAGAGTGGAGAGAACTTTAAGTTGTTATATGACTTGGCAGATCAACTACATGCTGCAGTTGGTGCTTCCCGTGCTGCTGTTGATGCTGGCTTTGTTCCCAATGACATGCAAGTTGGACAGACGGGAAAAATAGTAGCACCAGAACTTTATATTGCTGTTGGAATATCTGGAGCCATCCAACATTTAGCTGGGATGAAAGACAGCAAGACAATTGTGGCAATTAATAAAGACCCAGAAGCTCCAATTTTCCAAGTGGCAGATTATGGAATAGTTGCAGATTTATTTAAGGTAGTTCCTGAAATGACTGAGATATTGAAGAAAAAATGAATCAGGATCATGCCTTAAAAAGAAAACTTTTGTTAAAGTATTCCACTGAAATCACAGATATTTGTGGGTATTATAACAATCATTGGAAAGCATGGAGAGCTACATTTCATAATTTGAGGGAAAATTTCTAACAGATGCCAGAATGCTTGTTTATGGGATTGCTGTGTTTCCTTTTAATTATTTGTGGTTCCAAACAATTATTGTTTGAACTTTTTAAATTCTGTACTAAAATCTATAATAAAGCTTTTCCACAGCTTTAAAACTATCAGAAATATGCCTAGCCTCTAGAGAAAATTGAAGAAAAGGAGT