Transcript asmbl_31182

Sequence
Transcript Sequence for observation asmbl_31182 of TGE0004857:
GCACCATTCAAATGCCTCCTGCCAGCAACTTCCGCCCTTCTCGCTGAAGTCGGAGAACAGCGGCTCGGAACGGATGCTTTGCGCTTTTGCTGGAGTCGGTCGTTTTAGAAGTGTCCCTTTCCTGTCGCGAGTTGCGTGGAGTCAGCTCGCGGGTCTCCGAGACTCGAGAACTTGAGAACTTCTTTGCGTCCGGGGGATTGCGCCCCGCGGCTCGGCGGCCGTAATCATGCCACAAAACGAGTATATTGAGTTACACCGTAAGCGCTATGGATATCGTTTGGATTACCATGAGAAAAAGAGAAAGAAGGAAGGTCGAGAAGCTCATGAACGTTCAAAGAAGGCAAAAAAGATGATTGGTCTCAAAGCTAAGCTCTACCATAAACAGCGCCATGCTGAGAAGATACAAATGAAAAAGACTATCAAGATGCATGAAAAGAGAAACACCAAACAAAAGAATGATGAAAAGACTCCACAAGGAGCAGTACCTGCCTATCTACTGGACAGAGAGGGACAGTCCCGAGCCAAAGTACTTTCCAATATGATTAAACAAAAACGAAAAGAGAAAGCGGGAAAATGGGAAGTCCCTCTGCCCAAAGTTCGTGCTCAGGGGGAAACAGAGGTATTAAAAGTTATTCGAACAGGAAAGAGAAAGAAGAAAGCATGGAAGAGGATGGTTACTAAAGTCTGCTTTGTTGGAGATGGCTTTACTCGAAAACCACCTAAATATGAAAGATTCATTAGGCCAATGGGCTTACGTTTCAAGAAGGCCCATGTAACACATCCTGAACTGAAAGCCACCTTTTGCCTGCCAATACTTGGTGTAAAGAAAAATCCCTCATCCCCACTTTATACAACTTTGGGTGTTATTACCAAAGGTACTGTCATTGAAGTGAATGTGAGCGAGTTGGGCCTTGTGACACAAGGAGGCAAGGTTATTTGGGGAAAATATGCCCAGGTTACCAACAATCCTGAAAACGATGGATGCATAAATGCAGTCTTACTGGTTTGACAGTAGTTTCATACAAGTAACTCCTTATAATTATTGAAGACTATGCACCAATCAGGAAAACCATCTTTACCTGTGATGTTTCTGAGTACTACCAAACAGGTTACATGTCTGTACTCATTGACCTATTTATTTTATTGTAAAGAACATTAAAATGGTCCAGTTTTATAAATTGGTCTTTATTTTGGGGTCTGTT