Transcript asmbl_3111

Sequence
Transcript Sequence for observation asmbl_3111 of TGE0004844:
GAGGCTCAGGCTGCGTGAGTGGGCGTTGTATTGAGAGTAAAGAAGGAGGCCTTCCTCTTTGAACAAGATTACCTATTAAAGAGGTACCCTAAAATCTTTCCAGGTCTTGCTATTTGGGGAGCTACAAAGAAAAAACAAATTAAAGGAAGGTTGGTCTTTTAAGTGGACATGGCTCAGATATCCAGCAACAATGGATTTAAGCAATGTTCGTCTTCACATCTGGAACCACCAAGACCAAAAGATGTGGACAAAGAAGAAGCATTACAGATGGAAGCAGAGGCTTTAGCAAAACTGCAAAAAGACAGGCGAGTGACTGATAATCAGAGAGGCTTCGAGTTGTCAGGCAGCACCAGACAAAAAGCACAAGTTTATAACAAACAAGATTATGATCTCATGGTGTTTCCTGAATCAGATACCCAAAAAAGAGCAGTAGATATTGATGTAGAAAAGCTCACCCAAGCTGAACTGGAGAAACTATTGCTAGATGACAGTTTTGAGACAAGGAAAACACCTGTATTGCCAGTTACTCCTGCCCTGAGCCCTTCGTTTTCAGCACAGCTTTATCTTAGACCTACTACTCTTCAGAGGGGACAGTGGCCAACTGGTTTATCTGGGCCTTCAGCTTATACTTTACCTTCTATTTATCAGTCAACTTACAGCAGTAAACAGACTACATTCCAAAATGGCTTTAATCCAAGAATGCCTACTTTTCCATCCACAGAACCGATATATTTAAGTCTTCCAGGACAGTCTCCATATTTTTCATATCCTTTGTCACCTACTACATCTTTTCATCCACAAGGAAGCTTACCTGTCTATCATCCAGTAGTCAGTCCTGACATGGCAAAGCTGTTTGACAAAATAGCTAGTACATCAGAGTTTTTAAAAAATGGAAAAGCAAGGACTGATTTAGAGATAAATTCAAAAACTACAATCAGCAGCCTACAGGTATCTCCAAAGTCTGAAGATATCAGTAAATTTGACTGGTTAGACTTGGATCCTCTAAGTAAGCCTAAGGTGGACAATGTGGAGGTATTAGACCATGAAGAAGAGAAAAATGTTCCAGGTTTGCTAGCAGAGGATCCTTGGGATGCTGTTCTTCTTGAAGAGAGATCATCAGCAAGTTGTCACCTTGAAAGGAAGGTGAATGGAAAATCTCTTTCTGGGGCAGTGGTAACAAGAAGCCAGTCTTTAACTATTCGAACAACTCAGCTTACAAAAGTCCAGGGCCAAATATCTCAGAAAGACCCAAATGGGACCAGTAGTTTGCCAACTGGAAGTTCTCTTCCACAGGAATTTGAAGTACGGAATGAAGAAGTGGCAGCTTTTTGTCGATCCATTACAAAATTGAAGACCAACTTTCCATACACCAATCACTGCACAAATCCAGGCTATTTATTAAGTCCAGTCACAGTGCAAAGAAACATATGTGGAGAAAATGCTAGCGTGAAGGTCTCCATTGAAATTGAAGGATTTCAACTACCAGTTACTTTTACATGTGATGTGAGTTCTACTGTAGAAATCATTATAATGCAAGCCCTTTGCTGGGTGCATGATGACTTGAATCAAGTAGATGTTGGCAGCTATGTTCTGAAAGTTTGTGGTCAAGAGGAAGTGCTACAGAATAATCATTGCCTTGGAAGTCATGAACATATTCAAAACTGTCGAAAATGGGACACAGAGATTAAACTACGACTTTTGACCTTCAGCACAATGTGCCAAAATCTGGCCCGAACTGCAGAAGATGATGAAACACCTGTGGATTTAAACAAACACCTGCATCAAATAGAAAAACCATATAAAGAAGTCATGACAAGACACCCTGTTGAAGAACTTTTAGATTCTTATCATAATCAAGTGGAGCTGGCTCTTCAAGTAGAAAACCAGCACCGAGCAGTAGATCAAGTAATTAAAGCCGTAAGAAAAATCTGTAGTGCTTTAGACGGTGTAGAGACTCTTGCCATTACAGAATCAGTAAAGAAGCTAAAGAGAGCAGTTAATCTTCCAAGGAGTAAAAGTGCCGATGTGACTTCACTGTCTGGAGAAGGAGACACTAGCAAGAGTTCAACTCGGGGCTCACTGAATCCTGAAAATCCTGTTCAAGTAAGCATGGACCAATTAACTGCAGCAATTTATGATCTTCTCAGACTCCATGGAAATTCTGGTAGGAGTCCTGCAGACTGCATCCAAAGTAACAGGAACATCAAGGAAGCGTGGACTACAGCAGAACAGCTCCAGTTTACTGTCTTTGCTGCACATGGAATTTCAAGTAACTGGGTATCAAATTATGAAAAATACTACTTGATATGTTCACTGACTCACAATGGAAAGGATCTTTTTAAACCTATTCAATCAAAGAAGGTTGGCACTTACAAGAATTTCTTCTATCTTATTAAATGGGATGAACTAATCATTTTTCCCATCCAGATATCACAGTTGCCATTAGAATCTGTTCTTCACATTACTCTTTTTGGAATTTTAAATCAGAGCAGTGGAAGTTCCCCTGATTCTAATAAGCAGAGAAAGGGGCCAGAAGCTTTGGGTAAAGTTTCTTTACCTCTTTTTGATTTTAAACGGTTTTTAACATGTGGAACTAAGCTTTTATACCTTTGGACTTCATCACATACAAATCTGATTCCTGGAACAGTTCTCAAAAAAGGATATGTGATGGAAAGAATAGTGTTACAGGTTGATTTTCCTTCTCCTACATTTGATATCATTTATACCACTCCTCAAGTTGACAGAAGCATTATACAGCAGCACAACTTAGAAACATTGGAAAATGATATAAAAGGGAAACTTCTTGATATTCTTCACAAAGATTCATCGTTTGGACTTTCTAAAGAAGACAAAACCTTTTTGTGGGAGAAACGTTATTATTGCCTGAAACACCCAAATTGTCTTCCTAAAGTACTAGCAAGTGCCCCAAATTGGAAATGGGTTAATCTTGCCAAAACTTACTCATTGCTTCAGCAGTGGCCTCCATTGCACCCACTGACTGCATTAGAGCTTCTTGATTCAAAATTTGCTGATCAAGAAGTGAGGTCCCAAGCTGTGACCTGGATCGAGCCTATTAGTGATGATGAGCTAACAGATCTTCTTCCACAGTTTGTGCAGGCTTTGAAGTATGAAATTTATTTGAACAGTTCATTAGTGCGCTTCCTTCTGTCCAGGGCATTGGGAAATATACAGATAGCACACAATTTATATTGGCTCCTCAAGGATGCCCTGCATGATGCACAGTTTGGTGCCCGATATGAACATATCTTGGGTGCTCTCCTCTCAGTAGGAGGAAAAGGACTGAGAGAAGAACTCTTGAAGCAGACAAAACTTGTACAGCTTTTAGGAGTAGTAGCAGAAAAAGTAAGGCAGGCTAGTGGATCAGCCAGACAGGTTGTCCTCCAAAGGAGTATGGAACGAGTACAGTCTTTTTTTCTAAGAAATAAATGTCGCCTGCCTCTCAATCCAAGTCTTGTGGCAAAAGAATTAAATATTAAGTCATGTTCCTTCTTCAGTTCTAATGCTGTGCCCCTAAAAGTCACAATGGTGAATGCTGATCCAATGGGTGAAGAAATTAATGTCATGTTTAAGGTTGGTGAAGATCTTCGGCAAGATATGTTAGCTTTACAGATGATAAAAATTATGGACAAGATCTGGCTTAAAGAAGGACTAGATCTGAGGATGGTAATTTTCAAATGTCTTTCAACTGGCAGAGATCGAGGCATGGTGGAGCTAGTTCCTGCTTCAGATACTCTCAGGAAAATCCAAGTGGAATATGGTGTGACAGGATCCTTTAAAGATAAACCACTTGCAGAGTGGCTGAGGAAATACAATCCCTCTGAAGAGGAATATGAAAAGGCTTCTGAGAATTTTATCTATTCTTGTGCTGGATGCTGTGTAGCCACCTATGTTTTAGGCATCTGTGATCGACACAATGACAATATAATGCTTCGAAGCACAGGACACATGTTTCACATTGACTTTGGGAAGTTCTTGGGCCATGCACAGATGTTTGGTAGCTTCAGAAGGGATCGGGCTCCTTTTGTGCTGACCTCTGATATGGCATATGTCATCAACGGGGGTGAAAAGCCCACCATTCGTTTCCAGTTGTTTGTGGACCTCTGCTGTCAGGCCTACAACTTGATAAGAAAGCAAACAAACCTCTTTCTTAACCTGCTTTCACTGATGATTCCTTCAGGGTTACCAGAACTTACAAGTATTCAAGATTTGAAATACGTTAGAGATGCACTTCAACCCCAAACTACAGATGCAGAAGCTACAATTTTCTTTACTAGGCTGATCGAATCAAGTTTAGGAAACATTGCCACAAAGTTTAACTTCTTCATTCACAACCTTGCTCAGCTTCGTTTTACTGGTCTTCCTTCCAATGATGAACCCATCCTTTCATTTTCACCCAAAACTTACTCCTTTAGACAAGATGGTCGAATAAAGGAAGTCTCTGTTTTCACTTACCATAAGAAATACAACCCAGATAAACATTACATTTATGTAGTCCGAATTTTGAGGGAAGGACAGCTCGAGCCATCATTTGTGTTCCGAACATTTGACGAGTTTCAGGAACTTCACAACAAGCTCAGTATTGTTTTTCCACTTTGGAAGTTACCAGGGTTTCCTAATAGAATGGTTCTAGGAAGAACACACATAAAAGATGTAGCAGCCAAGAGAAAAGTTGAGTTAAACAGTTACTTACAAAGTTTGATGAGTGCTTCAACGGACGTAGCAGAGTGTGATCTTGTTTGTACTTTTTTTCACCCTTTACTTCGTGATGAGAAAGCTGAAGGAATAGCTAGGTCTGCAGATGCAGGTCCCTTCAGTCCTACTCCAGGCCAGATAGGAGGAGCAGTGAAATTATCTGTCTCCTACCGAAATGGTACTCTTTTCATCATGGTGATGCACATCAAAGATCTTGTTACTGAAGATGGGGCTGACCCAAATCCATATGTCAAAACCTACCTACTTCCAGATACCCACAAAACATCCAAACGTAAAACCAAAATTTCACGAAAAACTAGGAATCCAACATTCAATGAAATGCTTGTGTACAGTGGATATAGCAAAGAAACCCTAAGACAGAGAGAACTTCAACTAAGTGTACTCAGCGCGGAATCTCTGCGGGAGAATTTTTTCTTGGGTGGAATAACCCTGCCTTTGAAAGATTTCAATTTGAGCAAAGAGACGGTTAGGTGGTATCAGCTGACTGCAGCAACCTATTTGTAAGCTAGTGAATTTGTGAGCTTTGGAAGCAAGAACAGTTAAAACATGTGTGTGCT