Transcript asmbl_18182

Sequence
Transcript Sequence for observation asmbl_18182 of TGE0000493:
GCCGTGGGCTGCGTCTTCCTGCTGGAGCCAGAGCTGCCAGGCTCGGCGCTGCGCTCTCTCTGGAGCTCGCTGTGTCTGGGGCCCGCGCCTGCGCCCCCGGGACCCGTCTCCCCCGAGGGCCGGTTGGCGGCAGCCTGGGACGCGCTTATCGTGCGGCCAGTCCGGCGCTGGCGCCGCGTGGCAGTGGGAGTCAATGCATGTGTTGATGTGGTGCTCTCAGGGGTGAAGCTCTTGCAGGCACTTGGCCTTAGTCCTGGGAATGGGAAAGATCACAGCATTCTGCATTCAAGGAATGATCTGGAAGAAGCCTTCATTCACTTCATGGGGAAGGGAGCAGCTGCTGAGCGCTTCTTCAGTGATAAGGAAACTTTTCACGACATTGCCCAGGTTGCATCAGAGTTCCCAGGAGCCCAGCACTATGTAGGAGGAAATGCAGCTTTAATTGGACAGAAATTTGCAGCCAACTCAGATTTAAAGGTTCTTCTTTGCGGTCCAGTTGGTCCAAAGCTACATGAGCTTCTTGATGACAATGTCTTTGTTCCACCAGAGTCATTGCAGGAAGTGGATGAGTTCCACCTCATTTTAGAGTATCAAGCAGGGGAGGAGTGGGGCCAGTTAAAAGCTCCCCATGCCAACCGATTCATCTTCTCTCACGACCTCTCCAACGGGGCCATGAATATGCTGGAGGTGTTTGTGTCTAGCCTGGAGGAGTTTCAGCCAGACCTGGTGGTCCTCTCTGGATTGCACATGATGGAGGGACAAAGCAAGGAGCTCCAGAGGAAGAGACTCTTGGAGGTTGTAACCTCCATTTCTGACATCCCCACTGGTATTCCAGTTCACCTAGAGCTGGCCAGTATGACTAACAGGGAGCTCATGAGCAGCATTGTCCATCAGCAGGTCTTTCCCGCGGTGACTTCCCTTGGGCTGAATGAACAGGAGCTGTTATTTCTCACCCAGTCAGCCTCTGGACCTCACTCTTCTCTCTCTTCCTGGAACGGTGTTCCTGATGTGGGCATGGTCAGTGACATCCTCTTCTGGATCTTGAAAGAACATGGGAGGAGTAAAAGCAGAGCCTCGGATCTCACCAGGATCCATTTCCACACGCTGGTCTACCACATCCTGGCAACTGTGGATGGACACTGGGCCAACCAGCTGGCAGCCGTGGCTGCAGGAGCTCGTGTGGCTGGGACACAGGCCTGCGCCACAGAAACCATAGACACCAGCCGAGTGTCTCTGAGGGCACCCCAAGAGTTCATGACTTCCCATTCGGAGGCAGGCTCCAGGATTGTATTAAACCCAAACAAGCCAGTAGTAGAATGGCACAGAGAGGGAATATCCTTCCACTTCACACCAGTATTGGTGTGTAAAGACCCCATTCGAACTGTAGGCCTTGGAGATGCCATTTCAGCCGAAGGACTCTTCTATTCGGAAGTACACCCTCACTATTAGGAAGATTCTTAGGGGTAATTTTTCTGAGGAAGGAGAACTAGCCAACTTAAGAATTACAGGAAGAAAGTGGTTTGGAAGACAGCCAAAGAAATAAAAGCAGATTAAACTGTATCAGGTACATTCCAGCCTGTTGGCAACTCCATAAAAACATTTCAGATTTTAATCCGAATTTAGCTAATGAGACTGGATTTTTGTTTTTTATGTTGTGTGTCACAGAGCTAAAAACTCAGTTCCCAAATCCCCAGTTTATGCAGCGCCATCAGGTATTTTAAGCTAAACTTCTTCACCCCTGAGAGCATGTCAGCTGGAGAAAAGCAGTTCTTCCTTGCCCACTTGAGAAGTGCACGCCCACTCACCCAACATCCTGGTCTCTAGGAAAGCCTCATGTGAGGTTCCTCTTTCTTTCAGCTCAGTGCCCATGGGCAAGGATCATGATTTCCATTCCGTGTTACAATGACAATATTTAATGAGCATAACCTTCTCAGTCTCCTGCTCTCAAATTTAGGACAGAGCCGCTAAGGACAAAACAATCCCTCCCGTGCTTTATGATGGCAGCAGGGGCTGGGGAGCCTCTGAGGGACTCTTTCATTCTGCAGTTGTCTGGAAGCCTGGGTGGCGTCATGAGCTGAAGGATCATGCTTTCCTGTCCTGGCTCCATAGGTTATAGGCTGGCTGGTGAAAGGTTCACGTGGCCCAGGCTGAACTTCATTGCCTAGCTTTGGATGTGCTTTCTGCCATAAAGACTGATTTTTGTTCGTTCTGAGCCTTCAAGGAATTTGTTTTTTACAACTGGAATATGCTCCTGTGTGTGTTAACAGATCATGGATGTTTTATGTTTTCACTGATCATTTAAAGAGTTTGACCTCAGAGCTCCAGGATCATCAGTAAATTTGTCATGTTATATATTTATTTTTTTATAAATCAAGACTTCTGTGTGCTCTTAAATATATTAAAAACAATTTACATTTCAGGAATTCTGTCTGTAAT