Transcript asmbl_26351

Sequence
Transcript Sequence for observation asmbl_26351 of TGE0032915:
TCTGCCGTGGCTTCTGCTGTCTTTTCGGCGTGTGTGGACGCTTGTTCTCTGGGCGAGTGCGAGCCACCGTTTGGTCAACATGGGTCGCTCGGGGAAATTGCCCTCTGGTGTCTCGGCCAAGTTGAAGCGCTGGAAGAAAGGCCACAGCAGCGACAGCAACCCCGCCACTTGCCGCCATCGCCAGGCCGCTCGGAGCCGCTTCTTCAGCCGCCCGTCAGGAAAGAGCGACCTGACTGTTGATGCTGTGAAGTTGCATAATGAGCTGCAGTCGGGGACCCTGAGCCTGGGCAAAAGCCAAGCCCCTGAGACGACCATGGACCAAGATCCAGAGGTGGCTTTCACCGAGAAGTCCTCGGGCACGTTTCTGAGTGGCTTGTCTGACTGTACAAATGTCACTTTCAGCAAAGTGCAGCGCTTCTGGGAATCCAACTCAGCTGCTCACAAGGAGATCTGCGCTGTGCTGGCTGCTGTTACAGAGGTGATTCGATCCCAGGGAGGCAAGGAGACGGAGACCGAGTACTTTGCTGCTCTGATGACAACAATGGAAGCAGTGGAGTCCCCAGAGTCACTGGCTGCCGTTGCATACCTATTGAACCTTGTCCTGAAGCGGGTGCCAAGTCCTGTGCTCATGAAGAAGTTCTCTGATACCTCCAAAGCCTTCATGGACATCATGTCTGCGCAGGCGAGCAGTGGCTCCACCTCTGCTCTCCGATGGGTCCTCTCCTGCCTGGCCATCCTCCTTCGGAAGCAAGACCTGGAGGCCTGGGGCTATCCCATCACCCTTCAGGTGTACCATGGACTGCTGAGCTTCACCGTGCATGCCAAGCCGAAGATCCGTAAGGCTGCTCAGCACGGAGTGTGCTCAGTTCTCAAGGGCAGTGACTTCATGTTTGGTGAAAAGGCCCCTGCCCATCATCCTGCTGCCGTCTCCACTGCCAAGTTCTGCATCCAGGAGATTGAGAAGTCTGGAGGTTCCAAAGAGGCCACCACCACGCTGCATATGCTAACACTGCTGAAGGACATGCTGCCCTGCTTCCCGGAAGGCCTGGTGAAGAGCTGCAGTGAGACTCTGCTTCGGGTCATGACCTTGAACCATGTGCTTGTGACAGCCTGTGCCATGCAGGCCTTCCATAACCTCTTCCATGCCAAGCCCAGCCCTAGCACCCTGTCAGCAGAACTCAACGCCCAGATCGTCACGGCACTATATGACTACGTTCCCAGTGAGAATGATTTACAGCCCCTGCTGGCCTGGCTTAAGGTCATGGAGAAAGCCCACATCAACCTGGTCAGGCTGCAGCGAGACCTGGGGCTAGGCCATCTTGCTCGATTTTTCGGAACCGCAGTGACCTGTCTTCTCTCGCCTCATTCACAAGTGGCGGCGGCTGCTACCCAGACTCTCAAGGAGATCCTGAAGGAGTGTGTGGCTCCACACATTGCTGACATTGGCTCTGTGACCTCTTCAGCCTCAGGTCCTCCCCAGTACATCACTAAGATGTTCAGGGCAGTGGAAGAGGGCCTCACATACAAATTTCATGCAGCCTGGAGCTCTGTGCTGCAGCTCCTGGGGGTCTTCTTTGAAGCTTGCGGAAAGCAGGCCCATCCTGTGATGAAGAAGTGCCTCCAGTCCCTGTGTGACCTGCGCCTCTCTCCTCACTTCCCCCACACAGCAGCCCTGGACCAGGCTGTAGGGGCTGCAGTGACCAGCATGGGTCCCGAGGTGGTGTTGCAGGCCGTGCCCTTGGAAATCGATGGCTCTGAGGAGACTCTGGATTTCCCACGGAGCTGGCTGCTGCCTGTCATCCGGGATCATGTTCGGGAAACCAGGCTTGGTTTCTTCACCACTTACTTCTTGCCCTTGGCCACCACTCTTAAGAGAAAAGCAATGGACCTGGCTCAGGCAGGCAGCACAGTGGAGTCGAAGATTTATGATACACTCCAGTGGCAGATCTGGACCCTCCTGCCTGGGTTCTGCACAAGGCCCACAGATGTGGCTGCCTCCTTCAAAGGCCTGGCA