Transcript asmbl_26296

Sequence
Transcript Sequence for observation asmbl_26296 of TGE0032903:
GAAGACGGAGAACGGCGGCGGGAGCCGGGTTGCGAAGACCGCGCTGTCCGAGGCGCGCACGGCGCTGGCGCTCGCACTCTACCTGCTCGCGCTGCGGGCGCTCGTGCAGCTCTCGCTGCAGCGGCTGGTGCTGAGCCGGACCTCGGGGCTCCAGGGCGAGTTCGACGCGCGCCAAGCCAGGGATTATCTGGAACACATAACGGCCATTGGCCCCAGGACTACAGGAAGCACAGAAAATGAAATTCTGACGGTACAGTACCTTTTGGAGCAGATCAAGCTGATAGAAGCACAAAGCAACAGCCTTCACAGCATCTCCGTAGATATACAGCGGCCCACCGGTTCCTTTAGCATTGACTTCTTGGGGGGCTTCACGAGCTACTATGACAACATTACTAATGTCGTGGTAAAGCTGGAGCCCCGGGATGGAGCCGAGTCTGCTATCCTGGCTAACTGTCACTTTGACTCAGTGGCAAATTCACCAGGTGCCAGTGACGATGCAGTTAGCTGTGCAGTGATGCTCGAAGTTCTCCGGGTCATGTCAGCGTCTCCAGAGCCCATGCAGCACGCTGTGGTGTTCCTCTTTAATGGCGCAGAGGAAAATGTCTTGCAAGCAAGCCATGGTTTTATTACTCAACATCCCTGGGCCAGTTTGATTCGAGCATTTATTAACCTGGAGGCTGCTGGTGTCGGAGGGAAAGAACTTGTGTTCCAAACAGGCCCTGAAAATCCTTGGTTGGTCCAGGCTTACGTTTCGGCAGCTAAACACCCTTTTGCCTCTGTGGTGGCTCAGGAGGTTTTCCAGAGTGGGATCATTCCCTCTGACACCGACTTCAGAATCTACAGGGATTTTGGGAACATTCCAGGAATAGACTTAGCTTTTATTGAAAATGGATACATCTATCACACCAAGTATGACACAGCGGACAGGATTCTCATAGATTCCATTCAGAGAGCAGGTGACAACATTTTAGCAGTTCTTAAACACCTGGCTACGTCTGACACCCTGGCTTCTTCGTCTGAGTACCGGCATGGGAGCATGGTGTTCTTCGATGTGCTCGGCCTGCTGGTCATTGCGTACCCTTCTCGTGTCGGCTCCATAATCAACTACATGGTGGTCATGGCCGTGGTTCTGTACCTGGGGAAGAAACTTCTGCGGCCCAAGCACAGGAATGCTAATTACATGAGAGACTTCTTGTGTGGACTCGGGATCACATTCATTAGCTGGTTCACTAGCCTTGTTACCGTCCTCATTATAGCAGTGTTCATCTCTCTCATTGGACAGTCTCTCTCATGGTATAACTACTTTTATATTGCCGTTTGCCTGTATGGAACTGCAACAGTCGCCAAAATCATATTCATTCATACTCTTGCAAAAAGATTTTATTATATGAATGCCAGCGACCTGTATCTGGGAGAACTGTTCTTCGACACCTCCCTGTTCGTGCACTGTGCTTTTCTTGTTGCTTTAACTTATCAAGGGTTTTGCTCTGCATTCATGAGTGCCGTCTGGGTAGTTTTTCCATTGCTCACAAAGCTTTGTGTGTACAAGGACTTCAAGAAGCACGGTGCCCAAGGAAGATTTGTTGCTCTGTACCTTTTGGGGATGTTTATCCCATATCTTTACGGGCTCTACCTCATCTGGGCTGTGTTTGAGATGTTCACTCCTATCCTGGGAAGAAGCGGGTCGGAGATCCCCCCCGACGTTGTGCTGGCCTCCATCCTGGCTGTCTGTGTGATGATCCTCTCTTCCTATTTTATTACCTTCATCTACCTTGTGAACAGCACAAAGAAAACCATTCTGACTCTAATACTGGTGTGCGCGGTCACCTTCCTCCTTGTCTGCAGTGGAGCCTTTTTCCCATATAGTTCTAATCCCGAGAGTCCAAAGCCAAAGAGAGTGTTTCTTCAGCACGTGAGTAGAACTTTTCATAACTTAGAAGGAAGCGTAGTAAAAAGAGACTCTGGAATATGGATCAATGGGTTTGATTATACTGGAATGTCTCACGTAACACCTCACATTCCTGAGATCAACGACACAATCCGAGCTCACTGTGAGGAGGATGCCCCACTCTGTGGCTTCCCTTGGTATCTTCCAGTGCACTTCCTGATCAGGAAAAACTGGTATCTTCCAGCTCCCGAGGTCTCTCCAAGAAACCCTGCTCATTTCAGACTTGTGTCCAAAGAGAAAATGCCATGGGATTCGATAAAGTTGACCTTTGAAGCAACAGGACCAAGCCATATGTCTTTCTATGTTCGAACCCACAAAGGATCAACACTTTCCCAGTGGTCTCTTGGCAACGGCATCCCAGTCACAAGCAGAGGAGGAGACTACTTTGTGTTTTATTCCCATGGACTCCAGGCTTCTGCATGGCGGTTCTGGATAGAAGTGCAGCAGGTCTCAGAAGAACAGGCAGAAGGAATGGTGACTGTGGCCATTGCTGCCCACTATCTATCAGGGGAGAACAAAAGATCCTCTCAGCTGGATGCTCTGAAGAAGAAGTTCCCAGACTGGTCCTTTCCTTCGGCGTGGGTTTCCACCTACAGTCTCTTTGTGTTTTAATCTCGCGGATGGACTTTGAGTACATGTCCCCTGAACATTGCATGGGATAGTTTCTCTCCCATGATACAAGGATGTTTGTAATACAAGTCAATGAACTCTACTGAGCATATGTTCAAAGAGCTTTTGGGATAACACTCTTCAGGGCTAAGTACTGTATGGGTTAAACTTGGGGACAGTGATACCTGGCCATGCCGGTTGAAACTTCCTGTTTTCTGACAACTAAGCACATGTGGATATTGCCAATCATGTCACTCATGACTAAGGACTCAGCAGCATGCCTCTTGAGCAGCTTTCCTGTGAGGATCAAGAAAGATGTAGGCTCTTAGACCACTGCTAATGAAATAGGCAAGTCCACTTGCCAGTGGAGGTGGGTAAGATGCCTCTCTGTGCGCTACAACTGTAGTACTGGGAAGTAAATGCCACAAAGGTGGAAGCCGCTGCAGCACCTTAGATGTTCGAGCGCTGTTTCTTCAGGCAGCCGTTCAGATTTTTTTTGTCTGTTTGGAAGCCTAAGCCCTGATGCAGAGGCCTGACTCCTGAGTAGCATTCAGTGTCTGCTTTTCCCTCAAACACATTCCTGTCATTTACCTGGGGAAGAGAACATTTTTTTCAGCTACATTTTCTTCTTACATTTCATGGGTTGCTTTATTTGTGCAAGCACAGAACTTAAAACTTCTTCCCCAGAGCACTGAATTGCCAGCATAGCTGCTGAGGTGGAAGAGGAGGAGGGCTGGGAGGACTGGGGATTTTATAATATTTATTCTGTTATATATAAGATTAATCCTTTAGCACAAGTTCTTTATTGCTGCATTGGGTTTTCTGTTTTCTAGCAGGTGACTAAGTTGTTGTAACTTGCCGTCAGTGAGAACCGGCTGTCCTGATGTTGAGGTTGTAGCTTACACAGGAGACAACTATACCTGTATTTGTTAATTTTTAGATCCCGCATAAGGGCAGCAGTCAGACTTAATGGTGCTTTTCATTTTGAAGACAGGGATGTAGCTTGTGAGGTATGTCACGGCAGTGGCTCTTGTGGCGTCTCTAGGTTCCATCAGTGACAGAGGATGAGATGAACAGTAAATTATTCTAATTTTACAGTAGTAAATATACAAAGACAAAATTTGAGTTAGCTAACAAGCATGACACAAAATGTAGTTGAAAGAAAAGCCATAGTAAGGCAAAACCAAACCAAACCAAACCAAAC