Transcript asmbl_26208

Sequence
Transcript Sequence for observation asmbl_26208 of TGE0032892:
TTTCAGATGCAAGTCCACATCAGGCATGGAGATCTTGGGTGCCTTGAAGTGCATGTCAGGCATCTTAAACTTGGGGCCCTTCAGCTTTCCTTCTGGTCCCTCAAGGCTCACATCTGAGGTTTCAATGTCAAGTTTAGGTCCTGAGACATCAATAGTAGCCTTAGGCAAGCTCACATCCACATCTGGACCCTCACCTTTGAGAGTAGGCATACTGAACTTGGGCATTTTCATCTTTGGCATCTTCAGGCTCCATTCTGGGCCTTGCACATCCACTTCTGGTGCTTTAATATCTACATTTGGACCTTTAATGTCCACATCTGGAGCTTTCATCTCTCCCTCTATTTTTGGTGCAGACATGTCTAGATTTCCTTTCATTTTGGGTCCTTTGAGATCCAGATCCACATCTGGTAGAGACACCTTTGGAGCCTTGAAGTGCATCTCAGGCATCTTAAATTTGGGGCCTTTCAACTTCCCTTCTGGTCCCTCAAGGTTCAGATCTGGAGCACTAATATCTAGCTTTGGTACAGAAATGTCCACATCAGCCTTGGGCATGTTCACATCCAACTCTGGGCCTTCACCTTTGAGACTAGGCATGCTGAATTTGGGCATTTTAATCTTTGGCATTTTCAAGTTCCAGTCGGGACCATGAACATCAACATCTGGAACACTGACATCTACTTTGGGGCCTTTCAAGTCTCCTTCCAGCTTTGGCATTGTGACATCATATTCTCCTTTAACTTTGGGGCCTTTCATATGCAAATCCACATCAGGCATGGATATCTTTGGGGCCTTGATGTTCATCTCAGGCATCTTCAGCTTAGGACCCTTCAGCTTTCCTTCAGGTCCTTCAATGTTCACATCTGGAACTTTGACATCCACATTGGGTCCTGAGACATCAATGTCAGACTTTGGGAGATTCACCTCCATTTCTGGGCTCTCTGCCTTGAAGCCTGGCATGCCAAACTTGGGCATTTTTATCTTGGGCATCTTCATATGCAATTCAGGACCTTGAACATCCACATTTGGAACATCAATGTCCAGTTTAGCACTTTTAAGTTCAACATCAGGAACTTTAATCTCACCTTCTGCCCTTGGCACTGTGACATCATATTCTCCCTTTACATTGGGGCCTTTTAAGTGTAAGTCCACATCTGGCATGGAGATCTTTGGAGCTCTGATATTCATTTCAGGCATTTTAAACTTATGCCCTTTCAACTTCCCTTCTGATCCTTCAATGCTTACATCTGGAGCACTGACTTCCACCTTAGTCCCAGAAATGTCAAGGTCAGCCTTGGGCAGGTTCACATCCACTTCTGG