Transcript asmbl_26205

Sequence
Transcript Sequence for observation asmbl_26205 of TGE0032891:
CGCAATGCGCGTGCCCCGTTAGAGGCTAAACTGCTGGCAGGTCTGGTCTCTTCCTCTCTGTGCTCCTGCAACTTAAACCGAATTCCTGGAGGAGTCTTCCGGCTTGGGCCTCCGCTGTGGTGCGGTTGTTGGGCACAATGCTTCCGGCCTCTTGTGCCTCACTTGTGGACTGGAGACTCAGGCCTCACTCACTTCGGTTCCTCAATTAACAGCAGAACCATCAACAAATGTTTGTTGGATAAGGACAAATAAAGAGATTGGAAAGGAGCGAAGCCTTTTTGACTTGTTTCACTTGTTCCCGCCTACTCCATCTTCTTCCAGTTTCTCTTTCATTTAACAGTTCCAACAGTCATGGAGAAGCGCCTTCAGGAGGCTCAGGTATACAAGGAGGAAGGAAACCAGCGCTACCGGGAAGGAAAGTACCGAGATGCTGTGAGTAGGTACCATCGAGCTCTTCTTCAGCTGCGGGGTCTGGACCCAAGTCTGCCTTCCCCTCTTTCTAGTCTGGGACCTCAGGGCCCAGCTCTCACACCGGAGCAAGAAAACATACTGCACACCATCCAGACCCACTGCTACAACAACCTAGCTGCCTGTCTCCTCCAGATGGAGCCAGTGAACTATGAACGAGTGAGGGAATACAGTCAGAAAGTCCTAGAACGACAACCCGATAATGCCAAGGCCTTGTATCGGGCTGGAGTAGCCTTCTTCCACCTGCAAGACTATGACCGGGCTCGACACCACCTGCTTGCTGCTGTCAATAGGCAACCTAAAGATGCCAATGTTCGGCGGTACCTCCAGTTGACGCAGTCAGAACTCAGCAGCTACCATAGGAAGGAGAAACAGCTGTACCTGGGCATGTTTGGTTAATGAAGAAAAGAGACATTTCTCAACTTGAACTCAAGTGGACAAGCAAAGGCCCATTGGGGAATCTGAGCCTCACTCAGCAAAAGGAGTTCACCCTTTACCTCTGACCCAGGTGGATTTCCATTTTGTTTCCTGTTCTGCACAAGTTCTTTGCTCCTTAGACCATCTGCATCGTTTATTGTCTGTCCCCTAGTGTATTTGTATGGCTTACAATCTGAGAACATTCATCGACTGTGGGTGGAATCAACTGTATTTGTGGCATAGATTTAATGGGGTGTTATTAAATGTTCTCAGACACAGAGGAGAGGGCCGGTGAAGGGTGAGAGAGTAAGGACAGGCAAACAGGAATCTTCTGTAGTATCTTCAGATGCTTTTGTTTTGCTTAGTGGGATTTTTTTTTCTTTTAATTATAAATTGAGCCCAAGTATATTTACATTAAAGATTTGAAATTAGCTGGGTGTGGTGGCGCACACGTTTAGTCCCAGCACTTGGGGGAGTCAGGCAGATTTCTGAGTTTGAGGCTAGTCTGGTCTACAGAGTGAGTTCC